Specimen 850

Species Miliolida > Soritidae > Androsina > Androsina lucasi
Isolate number 850
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Dwarf mangrove forests
Depth 2-10cm
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtatatacttattaagagtatatgcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataatttattgttctgcctatatttatataggatttaaagtgaacatattataaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataattattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatattattatatgtatttattacattcaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattatttataaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Androsina lucasi | genomic DNA | 850 | taxon:128069 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcaatatatagataacttaaatataagttacttggataactaagggaaagtttggctaatacgtttaaatgtattataataaatacatatgcatataataatattgcaacatgatagatattatataaaaataagatatattttattatatcttataagagcagactttataatattttaattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttataataaacttaattaatatataataattaattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatattntatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatatttatyatattatttgaattttcaagtggagggcaagnnnnnnnnnnnnnnccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaactctcaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattattagcaatgaatgttttatcatggaatattgcatataatatttttgtcgatggaggtagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtatttttacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatattatactccttcaactaattaacattattttatatatgattgagtatttattttactctcatattaaatatatatattgatattttgataaaataaaatatcattatatgtactttgcgctcatataattatataggtgagatgtaagcattatagatgattaatatgtatagtatttatatattattacattattatgaatcttatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtatatacttattaagagtatatgcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataatttattgttctgcctatatttatataggatttaaagtgaacatattataaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataattattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatattattatatgtatttattacattcaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattatttataaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI