Specimen 6481

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides dispars
Isolate number 6481
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequence

SSU partial

>Cibicidoides dispars | genomic DNA | 6481 | taxon:892011 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA agggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattattttattatatgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaa

See sequence on NCBI