Specimen 6485

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6485
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6485 | taxon:892010 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA gccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttcatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgtatcacccatcacagtgaatcactgaaattacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcatcgttcggtgattttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaatttctttatggataactcagggaaagtttggctaatacgtacgagtaatttaccacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcaatggtaaactttggctgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatttataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaattccaagtggagggcaagtctggtgc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6485 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA tgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatactagttcgctctaattatgttaaatatgctagtcctttcttgattatgtgataagtggtgcatggccgttcttatttcgtggagtgatctgtcggcttaattgcttttcactaatggcctataaatttacgtgtgttgcggcactttgacccctttcttctcaaagcgcgtgtcttatgttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgccygtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagg

See sequence on NCBI