Specimen 14006

Species "monothalamids" > Clade I > Arnoldiellina > Arnoldiellina fluorescens
Isolate number 14006
Collector Laure Apothéloz-Perret-Gentil
Identifier Laure Apothéloz-Perret-Gentil
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATYTTACCGGGTCCGGACACACTGAGGATTGACAGGTTCTTTAACAAAAAAAATAATATATTTATATATTTTTTTATTTTGTTATTAAATATGCTAGTCCTTTCATGATTGTGTGATAGGTGGTGCATGGCCGTTYTTAGTTCGTGGAGTGATCTGTYTGCTTAATTGCGTTTCATTAATTAGTCGCTGATTTCATCAATAGTTGTTTAAACATTTTGTCACATATAACTTTTTTTTTTATTATTATAAAAATTTTAGTTTGTGCAATTATGTTTCAACTTAAAGGTGAACAGTGACACGAAGGCAACGAACGTGACCGCAACCTCTTGTTGCCTCCTTTCTTATAAAATTATATATATTTTTTTATATATTTTTTTTTAWAAGTTTATATATTTATTTTTTTATTTTAAAAAAATAAAATCGGAGGCTTTTCATTTTTTCATATTAWATTATTTTATTATTATTTTKGATTGCYCTTTTATTWAATTATAATKGGGTAGTTTTTAGATTTWATWAAAAATAWAATTTGAAATGAAAACAACTAGAGGGACCGCTAGAGTATTTTTTTAAAACAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGGCATCTAATACTAAAGTTTTTTTATTATTTTTTTATATTTTATTTTTAAAATATATTTTTATAATAAAATCTTTAAACCTGCTTCGAAAGTTTAGCAGGCAATCAATTGGAAGTAATGATTTCCCCTTTTCTGCTTTATATACATATTTTTTAAATATTATATTCTGTTCAGAATTGACGCACTTTTATATGCTTTATTTAATTGATTTTTTATAATATTTTTTTAATTTTATATAAAAATACTTTTAATTAAATGCATGTGCCCTAATTCTTTTAAATTTTTATATGTATATTTTTTTATATATATATATATAATTTAAAATAAAATTCGTGGTGGGGACARACCATTGCTAATTGTTGGWCTCGGWCTTAACTAGGAATGCCTTGTACGGGTCTT

See sequence on NCBI