Specimen 624

Species Rotaliida > Virgulinellidae > Virgulinella > Virgulinella fragilis
Isolate number 624
Collector Masashi Tsuchiya
Identifier Masashi Tsuchiya
Habitat soft sediment
Depth 16.7m
Location New Zealand, Wellington Harbor

Barcode sequences

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGCAATATTAATATTTCACAAGTACTTCGGTATCTTTGTCGATTTATTATG TTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATC TGTCTGCTTAATTGCGTTTCACTAAGGATCTATTTATTAACGTGTGTTGCGGCACTTTGACCCCTCATTT TTATTAATGTGCGCGTGTCTTAGTTTGCTTAGCTCACACAATTAGATCCTGAAAGCAACGAACGTGACCG CAACCTCTTGTTGCCTTTATACCAAACATGTTGGTTTTAAAGAATCCTTTTTTTATACCTTCGTGCAAAA AGGCTTTTTAAACTAGAGGGACCGCTGTTATCTTCTTAAACCAGAGGAAGATTGCGGCAATAACAGGTCT GTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTTTA CACACCGCATTCGCGAGTCCATTTATTCATCTTCGGGTGCTTTAAATGTGTATCTCTGCGAGCGGTAAAG CCTGCTTCGAGAGTAAGTGGGTAATCAATTAGAAGTAATGATTTCCTTTTTTTATAGCACACATATATAC AGCATTTATGCCCGGGTTGGCCTTGTTGTCAGCTTCTGTGTGTATAGATGTATATCTCAATTAGATTCTT TATGTCTCTTTTTAGATTCTGTATGTGCAATTGTCAATTCGTGGTGGGGACAGACCATTGTTAATTGTTG GTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGC CCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGTATTTTTG CCTATGGAAACTTAAACGAACAGTGTGGTCTAAAGGAAAGAGAAGTCGTAACAAGGCATCGGTAGGTGAA CCTGCAGAAGGATCA

See sequence on NCBI

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGCAATATTAATATTTCACAAGTTACTTCGGTATCTTTTGTCGATTTATTA TGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGA TCTGTCTGCTTAATTGCGTTTCACTAAGGATCTATTTATTAACGTGTGTTGCGGCACTTTGACCCCTCAT TTTTATTAATGTGCGCGTGTCTTAGTTTGCTTAGCTCACACAATTAGATCCTGAAAGCAACGAACGTGAC CGCAACCTCTTGTTGCCTTTATACCAAACATGTTGGTTTTAAAAATTCTTTTTTATACCTTCGTGCAAAA AGGCTTTTTAAACTAGAGGGACCGCTGTTATCTTCTTAAACCAGAGGAAGATTGCGGCAATAACAGGTCT GTGATGCCCTTAGATGTTCCGGGCTCCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTTTA CACACCGCATTCGCGAGTCCATTTATTCATCTTCGGGTGCTTTAAATGTGTATCTCTGCGAGCGGTAAAG CCTGCTTCGAGAGTAAGTGGGTAATCAATTAGAAGTAATGATTTCCTTTTTTTATAGCACACATATATAC AGCATTTATGCCCGGGTTGGCCTTGTTGTCAGCTTCTGTGTGTATAGATGTATATCTCAATTAGATTCAT TATGTCTCTTTTTAGATTCTGTATGTGCAATTGTTAATTCATGGTGGGGACAGACCATTGTTAATTGTTG GTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGC CCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGTATTTTTG CCTATGGAAACTTAAACGAACAGTGTGGTCTAAAGGAAAGAGAAGTCGTAACAAGGCATCGGTAGGTGAA CCTGCAGAAGGATCA

See sequence on NCBI

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGCAATATTAATATTTCACAAGTACTTCGGTATCTTTGTCGATTTATTATG TTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATC TGTCTGCTTAATTGCGTTTCACTAAGGATCTATTTATTAACGTGTGTTGCGGCACTTTGACCCCTCATTT TTATTAATGTGCGCGTGTCTTAGTTTGCTTAGCTCACACAATTAGATCCTGAAAGCAACGAACGTGACCG CAACCTCTTGTTGCCTTTATACCAAACATGTTGGTTTTAAAGAATCCTTTTTTTATACCTTCGTGCAAAA AGGCTTTTTAAACTAGAGGGACCGCTGTTATCTTCTTAAACCAGAGGAAGATTGCGGCAATAACAGGTCT GTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTTTA CACACCGCATTCGCGAGTCCATTTATTCATCTTCGGGTGCTTTAAATGTGTATCTCTGCGAGCGGTAAAG CCTGCTTCGAGAGTAAGTGGGTAATCAATTAGAAGTAATGATTTCCTTTTTTTATAGCACACATATATAC AGCATTTATGCCCGGGTTGGCCTTGTTGTCAGCTTCTGTGTGTATAGATGTATATCTCAATTAGATTCTT TATGTCTCTTTTTAGATTCTGTATGTGCAATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTG GTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGC CCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGTATTTTTG CCTATGGAAACTTAAACGAACAGTGTGGTCTAAAGGAAAGAGAAGTCGTAACAAGGCATCGGTAGGTGAA CCTGCAGAAGGATCA

See sequence on NCBI