Specimen 2264

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis spp.
Isolate number 2264
Collector Xavier Pochon
Identifier Maria Holzmann
Collected on March 2000
Habitat Reef rubble
Location Guam, Gun Beach

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis sp. 2264 | genomic DNA | 2264 | taxon:128067 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgactttgtaatatatataaataaatgttatctttggataactaagggaaagtttggctaatacgtttaatgtattaataatacacattcatataataataatacaacatgattgatattatataaatataaaatacatttattgtattttaaatagagatgactttataatatttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttaatatataatataaaaatatacactcaatttaattgaggcagtgacaagctgtaaagattcaatataaaaataaagataacatttggaattgtcgctttataatatttatattatattgcttgataatataccaatgttataaaatattgaatttgaatgcggtgaatgtaataatttcaagtaacatgtataaaatagtaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatatacacaacactgtgaacaaatcagagtgtataaaacatgtaatattaattattagcaatgaatgttttatcatgggatattgctaataatatataatataatataaacatgttatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatagatatataccctcaacttaaatattaatatgattgagtataattatatactctcatatatatattaatgttgataaatatttgattatatgtactttgcgctcatataattatataggtgagatgtaagcattattaatgattaatatacttataatttttaataattataatgtattattatgatttaaatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtattattatatattatatatataataatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatattacattaatatttagttctgcctttatggatttaaagtgaacatattatgttaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataatatttataatatattaatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattgtacacataatgatatattatatcattataataaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattaatataataactacattaataatacataatattatatattatatataatatatgtagtagtattatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttataatattaatttaataggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI