Specimen 72

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 72
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1995
Habitat soft sediment
Location Puerto Rico, Isla Magueyes

Barcode sequence

SSU partial

>Archaias angulatus | genomic DNA | 72 | taxon:46130 | Puerto Rico | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatataataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataataatattttagttctgcctttatggatttaaagtgaacatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattcatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacattatatttattatataaattaaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattattataatacacatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacatatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI