Specimen 875

Species Miliolida > Peneroplidae > Spirolina > Spirolina arietinus
Isolate number 875
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Location USA, Florida Keys

Barcode sequence

SSU partial

>Spirolina arietinus | genomic DNA | 875 | marine sediment sample | taxon:577499 | 13 | USA:Florida Keys | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgganatattgaggattgacaggcgatatatatcatattcattatgatataataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattaataataatatataaatatataatttaatattattttatactgttctgccaattatttaattggattttaaagtgaacgtatatatttattaatttatattattatatattaataatgaatgcaacgaacgtgaccgtaaccttttattgctataataatataatatagcataaaattaaaggaaccgctgtcattttatatgttttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatatatattgtagcatattgtgctaataataaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattataaataataatatatatatattattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggacttatgtcactttgttgacaaagaaactttaatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI