Specimen 312

Species Miliolida > Soritidae > Parasorites > Parasorites sp.
Isolate number 312
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on October 1996
Habitat soft sediment
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgcattaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttaaataaaatattataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Parasorites sp. 312 | genomic DNA | 312 | taxon:128075 | Japan: Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttataataagatttagtatcctaattggataactaagggaaagtttggctaatacgtttaataatacatatacatataatatttaatgatagatattatataaattaaaaatacatttatttgtattttaaatagagtagactttatattattataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgattaatatataaccttgtattactgacttttattgaggcagtgacaagctgtaaagattaaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatatttaatttgaatgcggtgaatctaataatttcaagtaacatgtataaaatatttaattattttatatgttatcagaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatatattattatacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatattatgcaatgaatgttttatcatggaatattgctaatatattatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatattttattactctcaactaattaattaaatatgattgagtaatatttattattttactctctatttaaaaaatttatgattcaaaaaatatgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgatcaatatatattatattatataatatattattgtaatccttaaaattaaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgcattaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttaaataaaatattataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI