Specimen 483

Species Miliolida > Soritidae > Parasorites > Parasorites sp.
Isolate number 483
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Habitat soft sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctttaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagagatttaaacataatgttataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Parasorites sp. 483 | genomic DNA | 483 | taxon:128074 | Australia: Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatatatatgttatgaatagttatttggataactaagggaaagtttggctaatacgtttaataataaatatacatataatattttaatgatagatattatataaattaaaaatacatttatttgtattttaaatagagtagactttatattattataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgattaatatataaccttgtattactgacttttattgaggcagtgacaagctgtaaagattaaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatatttaatttgaatgcggtgaatctaataatttcaagtaacatgtataaaatatttaattattttatatgttatcagaattttcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatatattattatacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatattatgcaatgaatgttttatcatggaatattgctaatatattatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatattttattactctcaactaattaattaaatatgattgagaagtaattctctctatttaaatattttatgagataaataattatgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgatcaatatatattatattatataatatattattgtaatccttaaaattaaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctttaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagagatttaaacataatgttataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI