Specimen 676

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 676
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Sea grass meadow
Depth <1m
Location USA, Florida Keys, off Keys Marine Laboratory
Latitude, Longitude 24.49, -80.48

Barcode sequence

SSU partial

>Archaias angulatus | genomic DNA | 676 | taxon:46130 | USA:Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatataataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataataatattttagttctgcctttatggatttaaagtgaacatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacattatatttattatataaattaaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattattataatacacatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI