Specimen 1361

Species Miliolida > Soritidae > Amphisorus > Amphisorus hemprichii
Isolate number 1361
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on April 1999
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacaaacatatcatatgtatgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggatttaaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattataatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttatatatttattttaggaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Amphisorus hemprichii | genomic DNA | 1361 | taxon:126669 | Israel: Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgactttgtaaaatgttattttatttttataggataactaagggaaagtttggctaatacgtttaattttacacatgtaaatatgcatataataatattgcaacatgatagatattatataaatataaatataaatattttatttatattaatatagagcagactttataatatttatttattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatataattgaggcagtgacaagctgtaaagattgaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatattcaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatatttattattttatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaattatattttacattacttttgtaatgttaatactgtgaacaaaccagagtgtataaaacatgtaatattatatatattatgcaatgaatgttttatcatggaatattgtttatttcgatggagatagttggagttaagagtacttataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaataatatattattcttaatacccctaacatatttaatatttattgattgagataattaatatatttatctctcataaaatataaaataatatagtggtacaatatttattatatgtactttgagctcatataattaatataggtgagatgtaagcattataggtgaacaatatatttatattataaatattattggaatccttataaataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacaaacatatcatatgtatgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggatttaaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattataatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttatatatttattttaggaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI