Specimen 337

Species Miliolida > Soritidae > Amphisorus > Amphisorus kudakajimaensis
Isolate number 337
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on December 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Amphisorus kudakajimaensis | genomic DNA | 337 | taxon:1005670 | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgataatcaacatacaatttctttgttgttggtataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagtttgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatatataatgtattaatattttagttctgccatttttaatggattttaagtgaacaatattatacatatatattaatatatgaatgcaacgaacgtgaccgtaaccttttattgctattattaatatattatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataataaatatttatatacatttaatgtataataatattgtaaaacctatttcgaaagtaaatcggtaatcatttaaagatcgtaataaataataatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttataatatttattttaggaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI