Specimen 21

Species Rotaliida > Nummulitidae > Cycloclypeus > Cycloclypeus carpenteri
Isolate number 21
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 80m
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatcactcttacgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacacagttctatcatttcgatgtagatgtgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgccttagatgttcgggttgcacacgtgctacaatgattatgcagtgagcatctcattttttacaccaccgcatgcgcgagtctatttatccaccttttgtgtgccttaaaatatgtatcttttgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttaatagcacacatatataacggcgtcttttacccggctttgccttgttgcaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctttatatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaggtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Cycloclypeus carpenteri | genomic DNA | 21 | sediment sample | taxon:196926 | single cell | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattacacgaggttgtttacgggagtaacaatttcagcgtgaatcacaccatacagtgaatcactgaaatatattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatgatacgtatacactgtatcgtatcatatatatatacacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcattcacatacacatacatacacatacacactcaatgcatatgtaagacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttaaagtttaattgcaacatgagagacattgagcacgcacgtgtcgtaccttcaggtgcttcacattacgctgagcggacttttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacacatacgattgatattattacgcgttaacaatttactgacaacacacatacagtgtgcagcatatatataacacaattatatttattctgtcacccgacagaacatacacacatccttgttcacgtaaatatcctcgctatatgtaatttattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttctggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatacgaatgaattctattcattctgcgtttgatagtttttacgcgttactttatatgtctcgcgtatcgacgctacctaaatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttatacatgcacactctctcctgtatcatcacacacatacacacccactgcagcaactgagtgattatatcattatatcatacgtcatcgtacgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtacatacgctgcgcttaacacacacatacacaccccgctgcagcagctgggtaaagcttatattatacgctatgtatataattcatataacggtataaatggccatggggatagttggaggtcacagtgctgctgggcgagaggtgaaattcattgaccctagcaaggacttccaaaagcgaaagccagttggctaaggctaaactcttgggcttgtggcacgtgataaataccgtaaagtctcgctgtttcacacacacacacatacatacctctgcagcagagatatattttatacgtatcaacgtagcacattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaatacaagattgtactgcgtgcacttattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttgggcatttcatctgtcgtgttgtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatattgctctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatcactcttacgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacacagttctatcatttcgatgtagatgtgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgccttagatgttcgggttgcacacgtgctacaatgattatgcagtgagcatctcattttttacaccaccgcatgcgcgagtctatttatccaccttttgtgtgccttaaaatatgtatcttttgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttaatagcacacatatataacggcgtcttttacccggctttgccttgttgcaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctttatatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaggtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI