Specimen 1686

Species Miliolida > Soritidae > Marginopora > Marginopora vertebralis
Isolate number 1686
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Location Guam, Pago Bay

Barcode sequence

SSU partial

>Marginopora vertebralis | genomic DNA | 1686 | taxon:126667 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatataattcatttatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatattataatatttagttctgccatgcataatatgtatggatttaaagtgaacatattatatatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctactatacattgtagcataaaattaaaggaaccgctgtcattactaatatgtgttaaaatagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatataatatatattgaatattaatatatattataaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattaatataaaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggattataatatatataatatacaaacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI