Specimen 16

Species Rotaliida > Nummulitidae > Planostegina > Planostegina operculinoides
Isolate number 16
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 80m
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcacttacatattcttaataatatgtctagtggtatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacgttgcagtaatatttttcattactttgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtggatgcccttagatgttccgggctgcacacgtgctacatgattattgcagtgagcatctcatttatacacaccgcatgcgcgagtcttatttattcacccatttgtgtgctttaaatatgtatcttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatacctcttgtatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Planostegina operculinoides | genomic DNA | 16 | taxon:196931 | 14 | Japan | Jun-2003 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattacacgaggttgattacgggagtaacaatttcagcgtgaatcacaccatatagtgaatcactgaaatatacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatgatacgcatacactgtatcgtatcatacatacactgtacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctatctcattcacacacacacatacacatacatcaatgtatatgtaagacactactcagcactcaatgggtaaactttgggcttcgttcgcgtcgccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtgcttcacatctacgccgagcagacttttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaaaagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcaacaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacccactctaactattagataggggtgtgcagcatatataacacaattatatttattctgtcacccgacagaacatacacacacacaatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaatggttgagtataaaaatgacgagtgtctggcattgccgctccttctggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgaatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatacgaatgaattctattcattctgcgtttgatagtttttacgcattactttacgtctcgcgtattcgacgctacctaaatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttatacatgtcacgcacagacgcttacagtagtgcttacacacacacacacatacacagactgtagcgactgagtgatttactataacatacgtcatcgtacgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcttgttaagaattattacgtacattacgctgcgccttcatacacatacacacccgctgcagctctcgtaaagcttatacgctatgtatgattcataacggtttaaaaatgtcgatgggggatagttggagtcacagtactgctgggcgagaggtggaattcattgaccctagcaaggactaccaaaagcgaaagcaattggctaaggctatactcctttggcttggcgcacgtggaccacctgagaatacgtaagtctcacgctggcaggtcatatcacacacacacacacacacacacttctgcagcagagatacatacaatcacgtatcaacgtagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagatacccttgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtaaccctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgttgtggtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttgctttccaggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcacttacatattcttaataatatgtctagtggtatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacgttgcagtaatatttttcattactttgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtggatgcccttagatgttccgggctgcacacgtgctacatgattattgcagtgagcatctcatttatacacaccgcatgcgcgagtcttatttattcacccatttgtgtgctttaaatatgtatcttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatacctcttgtatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI