Specimen 662

Species Rotaliida > Nummulitidae > Planostegina > Planostegina operculinoides
Isolate number 662
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on November 1997
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Planostegina operculinoides | genomic DNA | 662 | taxon:196931 | 1 | Japan:Minnu | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcacttacatattcttaataatatgtctagtggtatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacgttgcagtaatatttttcattaccttgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttatacacaccgcatgcgcgagtctatttattcaccatttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatacctcttgtatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

LSU partial

>Planostegina operculinoides | genomic DNA | 662 | taxon:196931 | 18 | Japan:Minnu, Okinawa | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaactaaccaggattcccttagtaacggcgagtgaagtgggaagcaatgcatacgtcgcgtaatttattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacctctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatacacataccacgcatgcatataatacacacacacacatacacaccccgctgcaagtgctattacatatagtgtatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatcattgtagttttactacagccatagagtgtgacagccacgttttatggaatttgatatactctcgtaacacacacacgcgcagtcttatgtatatatatatgcccctgcagtgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI