Specimen 17

Species Rotaliida > Nummulitidae > Planoperculina > Planoperculina heterosteginoides
Isolate number 17
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 80m
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcactcactctctgtagtagtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacgttgcagtaatattttcattaccttgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgccgagtctatttattcaccatttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctcttatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Planoperculina heterosteginoides | genomic DNA | 17 | sediment sample | taxon:311573 | single cell | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattacacgaggttgtttacgggagtaacaatttcagcgtgaatcacaccctatagtgaatcactgaaatatacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcttatatgatacgcatacccagtatcgtatcatacatacactgtatacacatacattgatttctctgtatcgcttgcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctatctcattccacacacatacccctacattcatgggtatgtgaaagactactcagcactcatagggtaaactttggcttcgttcgcgtcgcccgtttaaagttaactgcacctgagagacattgagcacgcacgtgtcgaacctttgggtgcttcacatcttcgctgaaacagactttgcgaagtttactttgcgaagcatgcagcatacaagcatctacagcatcaagtccaggttggcaagtgtattttgacctttcaagagcagtcacgcatagggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttttaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacccactctatatattagatgggcgtgtgcagcatatataacacaattatttattctgtcacccgacagaacatacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaatggttgagtataaaaatgacgagtgtctggcattgccgctccttctggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgaatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatatgaatgaattctattcattctgcgtttgatagtttttacgcgttacttttacgtctcgcgtatcgacgctacctacatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttatacatcatgcacagacgctcacagtagtgcttacacacacacacacatacacaagctgtagcgactgagtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcatgttaagaattattacgtacatacgctgcgcttaacacacatacacacccgtagcagcgctagtaagcctaagcttatacgctatgtataattcataacggttttaaatgtcgatggggatagttggagtcacagtactgctgggcgagaggtgaaattcattgaccctagcaagacttaccaaaagcgaaagcagttggctaggctatactctttgtgcttgcgcacgtgaccactgtgatacgtatgtctcacgctgtcagtcattacacacacatacacacttctgcagcagagacatacacacgtatccaacgtagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgttgttgtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatatttcactccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcactcactctctgtagtagtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacgttgcagtaatattttcattaccttgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgccgagtctatttattcaccatttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctcttatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI