Specimen 494

Species Rotaliida > Nummulitidae > Operculina > Operculina ammonoides
Isolate number 494
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcattactatacgtatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagtcctatatattttatatagactttgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgccaattcatggtggggacagaccattgttaattgttggtctcggtcttaacaaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatatttcatatattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Operculina ammonoides | genomic DNA | 494 | taxon:378197 | 5 | Australia | Aug-1997 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaaatgctacccatacacactcatacacgcattacacgaggttgtttacgggagtaacaatttcagcgtgaatcacatccatacagtgaatcactgaaatgtattacattacagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctctatatatgcatggtacatgtatcatgtaatatatattctgtatacacacatacattgatttctctgtatcgcgcttatcttaataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcatatcatttacatacacatacacctatcaatgtatctatgtaagacacacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcttcacatctacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacatacagtgtgcagcatatataacacaattatatttactctgtcacccgacagtgtacatacatacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatatgagtgaattctaattcattctgcgtttgatagttttttacgtgctacctttatacggttcgcgtatcgacgctacctaaaatgaaattattaccacgtatacggtttaccgtgctacagtaatatttcttatacacgcacactcgctcgctgtatcacacatacataacctactgcagcaactgagtgatcaatataccatacgtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtgcatcgcacacacatacacacccgctgcacacagcgcttagtaagcttatattacgctatgtatataattcataacggttataaatgtcgatgggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgcttgcgcaggtgattatatattttctatcgcagtcacacacacatacatacacacttctgcagcagagatattatataacacttacagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctagtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgtaacataagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttgggcatttcatctgtcgtgttgtaattaaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttcatctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcattactatacgtatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagtcctatatattttatatagactttgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgccaattcatggtggggacagaccattgttaattgttggtctcggtcttaacaaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatatttcatatattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI