Specimen 49

Species Rotaliida > Nummulitidae > Operculina > Operculina complanata
Isolate number 49
Collector Johann Hohenegger
Identifier Johann Hohenegger
Depth 80
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Operculina complanata | genomic DNA | 49 | sediment sample | taxon:311569 | single cell | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatttacactctcttaacgtgtgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctctttatagagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataccaaacacgttgcagtaatatttttattatctcgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattatgcagtgagcatctcattttttcacaccgcatgcgcgagtctatttattcaccatttgtgtgctttaaatatgtatctctgcgcgcggtaaagcttgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI