Specimen 301

Species Rotaliida > Nummulitidae > Nummulites > Nummulites venosus
Isolate number 301
Collector Johann Hohenegger
Collected on October 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtataacactwtttaygtgttatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataaccaaacacgtgcagtaataattcttattatctcgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccatcttgtgtgttttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequences

SSU total

>Nummulites venosus | genomic DNA | 301 | taxon:159862 | single cell | Japan:Sesoko Okinawa | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattatacgaggttgattacgggagtaacaatttcagcgtgaatcacacccacagtgaatcactgaaatatacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatgattacgcatactctgtatcgtatcatatattatacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcattcacacacatacacatacattcaatgtatatgtaagacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttgaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtgcttcacatttacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacgattgatattattacgcgttaacaatttactaacacacacatataaattatatagtgtgcagcatatataacacaattatatttattctgtcacccgacagaacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgtttgtaatatttcactgttcacgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatatgaatgaattctattcattctgcgtttgatagtttctacgcgtcactatatattatatagtctcgcgtatcgacgctacctaaatgaaattattaccacgtatacggtttaccgtgttacagtgatatttctacaacatgcacactcgctcgctgtatcataccacacatacacaatctctgcagcagctgagtgatacaatataccatacgtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtacatatgctgcggttaacacacatacacacccgctgcagcagctggtaagcttattattatacgctatgtataaattcataacggttataaatgtcgatggggatagttggagtcaacagtwctgctggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgcttgcgcgcgtgatataataactctcgctgtctatacacacatacacactctgcggcagagataatacattatatatgcagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtcttcgggcatttcatctgtcgcgttgtaattaacaccatttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatattgttctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtataacactwtttaygtgttatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataaccaaacacgtgcagtaataattcttattatctcgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccatcttgtgtgttttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

LSU partial

>Nummulites venosus | genomic DNA | 301 | taxon:159862 | 1 | Japan:Minnu, Okinawa | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaactaaccaggattcccttagtaacggcgagtgaagtgggaagcaatgcatacgtcgcgtaatttattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacctctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatacactacgcagtcatattatacacacacatacacaccccgctgcaagtgctataataatacatacagtgtatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatcattgtagttttactacagccatagagtgtgacagccacgttttatggaatttgatatactatatcgcacacacgcagtcttattgtatatgtcacgcggtagaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI