Specimen 54

Species Rotaliida > Nummulitidae > Operculina > Operculina elegans
Isolate number 54
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Depth 40m
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatttacactcttacagtgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaacagagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataccaaacaccgttgcagtaaatatttttaataatcttgcttcgtgcaaaaagggccttttaaactagagggaccgctggttactttcttaaaccagaagaaggttgccggcaataacagggtctgtgatggccttagatggtccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctaattattcaccattttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttatatagcacacatatatcggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Operculina elegans | genomic DNA | 54 | sediment sample | taxon:311568 | single cell | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacactcatacacgcattatacgaggttgattacgggagtaacaatttcagcgtgaatcacatcatatagtgaatcactgaaatacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatgattacgcatacactgtatcgtatcatatattatacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcattcacacacatcacacatacacactcaatgtatatgtaagacactactcagcactcaatggtaaactttggcttcgtcgcgtcccaggtttaaaggtttaactgcacatgagagacattgagcacgcacgtgtcgaaccttcgggtgcttcacatttcgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcccgtacaatgagagaccgttcttagttctaaggaacgcagcaggcgcgtaaattgccccaatgctagtaccctacaatcacatacgattgatattattacgcgctaacaatttactaacagcatatataacacaattatatttattctgtcacccgacagaacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgtttgtaatatttcactgttcacgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaattatatgaatgaattctattcattctgcgtttgatagtttctacgcgtcactatatattatatattgtttcgcgtatcgacgctacctaaatgaaattattaccacgtatacggtttaccgtgttacagtgatatttctgataacatgcacactcgctcctgtatcgttacacacatacacactctctgcagcaactgagtgatacaatatatcatacgtcatcgtacgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcaatgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtacatatgctgcgctttaacacacatacaccactcacagcagctagctggtaagcttattgttatacgctatggaataaaattcaataacgggttaataaaatggtcgatggggataagttgggagtctacaagtactgctgggcgagaggtggaaattcattgaccctagcaaggacttccaaagcgaaagccagattggcttagggctatactccttggtgcttgcgccacgtggattatacgtaataagtctcgctgtccctaacaccacatacacactttgcggcagagatattattattatacacgtatccacgtagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcgcttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtcttcgggcatttcatctgtcgtgttgtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatattattctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatttacactcttacagtgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaacagagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataccaaacaccgttgcagtaaatatttttaataatcttgcttcgtgcaaaaagggccttttaaactagagggaccgctggttactttcttaaaccagaagaaggttgccggcaataacagggtctgtgatggccttagatggtccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctaattattcaccattttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttatatagcacacatatatcggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI