Specimen 12

Species Rotaliida > Nummulitidae > Operculinella > Operculinella cumingii
Isolate number 12
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Depth 65m
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatctgcttattatgcagatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaactgagcgcgtgtctttgtttgcttagcgcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacatagttctatccttttacaggattaggctttgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttatacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatcttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatggtttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctttatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Operculinella cumingii | genomic DNA | 12 | sediment sample | taxon:311570 | single cell | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagaggttatattaacccgacagtttaaataagtgttaaaatgctacccatacacactcatacacgcattatacgaggttgtttacgggagtaacaatttcagcgtgaatcacatcctacagtgaatcactgaaatgtattacattcagtatcacttacgcaactgcagacagctgcttaatacggtcacacttgtcttgacttggctcatatgattcgcatacactgtatcgtatcatatattttctgtgtatacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataactctccacatgactacatacacatacacactcaatgtatatattgtatatgtaagacacatactactcagcactcaatgggtaaactttgggcttcgttcgcgtcgccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcttcacatctacgctgaacagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcagtcacaggttggcaagtgtattttttgaaccttcaagcagtccgcatacggaagagtagtttctgatccattgaaggagccccgtacaatgagagaccgctcttagttctaaggaacgcaacaggggcgtaaattgcccaatgctagtcccctacaatcatatatcggttgatattattacgcgttaacaatttactgacaacacacataaatttgtttattgtgtgcagcattatataacacaatttattctgtcacccgacagaacatacacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgtcatgtatttgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatatgagtgaattctattcattctgcgtttgatagtttttttacgcgtaaccttatattattattattatataagtctcgcgtatcgacgctacctacatgaaattattactacgtatacggtttaccgtgtcacagttatatttcttatacagacacacgcacactcgctcgctgtatcgtaacacacacatacacaccctctgcagcaactgagtgatcaatataccatacgtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgtaagaattattacgtacatatgccgcgcatatctatccacacatacatacacacccgctgcacgctggtaaagctttatatttaccctatggataatctaacgggtataaatggccatggggatagttggagtcacagtactgctgggcgagaggtggaatcattgacctagcaagataccaaagcgaaagcaattggctagtaaacctcttgggcttgcgccagggattaactcctctggttttcacaccacatccccatttgtgcagcagagataggtatatccattaccggtagcgcattacactttcaatgaagaacgaaggttgggggatcaaagaggatcagataccctgtcgtccccattaattacatcaaacgatgggctctcaattgcatttacttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgtgttgtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatattcttctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatctgcttattatgcagatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaactgagcgcgtgtctttgtttgcttagcgcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacatagttctatccttttacaggattaggctttgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttatacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatcttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatggtttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctttatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI