Specimen 13207

Spirophtalmidium sp._13207
Species Miliolida > Ophtalmidiidae > Spirophtalmidium > Spirophtalmidium sp.
Isolate number 13207
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2011
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 15 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtgggtgtatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggacttgnttgtagcttaagccggtgaaatgannnnnngagaacgaacgtgacccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 1 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagnatgtggcttannnnnnctcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcagtattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacaggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 2 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaacagcgcgtggagctgtggcttanntngactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttagaaacaaggcaaataatatacagaggctctatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggnnnnnnnaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 4 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggccgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctctatatatataatataggggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggancgctagaaatactcgttaaaacggaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccatatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgcgaacagtgtggtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Spirophtalmidium sp. 13207 | genomic DNA | 13207 | marine sediment | taxon:998815 | 5 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcaagtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggctcttcagttgtctagcctttttaaaaaccaatatacttctcctttattatataaagggttgtattcttttaaattgattcgatcatcgatcaaatatgctagtcctttcatgattgtgtggtaggtggtgcatggncgttcttagttcgtggtgtaaactgtctgcttaattgcgtttcattacgtgtttctaatagaacactggttgttaggctccctttatatatataatataagggtgctattgcattcctttattatttttaaaagggccttgtatgcttaagccggtgaaatgaaaccggaaggcaacgaacgtgaccgcagcctcttgttgccttttgttttgcccttttacttgttaaaaacaaggcaaataatatacagaggctttatataaaactagagggaccgctagaaatactcgttaaaacagaggaaggtggcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattatagcagtgagcatctttagaacatctaaacgtacttaaaaggagacaggtatatagcactagcatgttgtaaccttcccttttaatttaacctgctttgaaagtaagcagggaatcaatgagaagtcgtagtttccctttattattgttatttactcttttataaatgtagtattaacaatcaatattgaagcacatctatatgctttagtgttcaactgtaatgcatataaggggttttcagttttaactaataccccttgctttacagctaatagcatgtgcttaaaaataaaacaagtctctgttgctttggtacacttataacgagactgcttttaaaattcgtggtagggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatntccctgccctttgtacacaccgcccgtcgctcttaccgatgaactacgctgtgagtttaagggactggctttagtctttatatagccttatatataactatatacctatatagttgtttagtgctatgggctagctatggaaacttatgngnncnnnngtttaaaggaaagagaagtcgaacaaggca

See sequence on NCBI