Specimen 13213

Siphonaperta sp._13213
Species Miliolida > Hauerinidae > Siphonaperta > Siphonaperta sp.
Isolate number 13213
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2011
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 26 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggnnnatttgactcaacgcggggaaacttaccgggtccggacacactgaggattgacaggcgtttacttgttttgtgttgnttnctttggcgacttcggtcaaaagggaagnnttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagantcccgcctgtgcttgtggtacgccacgagtacggtttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccnntttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 27 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcggggaaacttaccgggtccggacacactgaggattgacaggcgtttacttgttttgtgttgtttctttggcgacttcggtcaaaagggaagcttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagaatcccgcctgtgcttgtggtacgccacgagtacggcttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccactttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgaagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Siphonaperta sp. 13213 | genomic DNA | 13213 | marine sediment | taxon:998812 | 28 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgctggagcatgtggcttaatttgactcaacgcggggaaacttaccgggtccgacacactgaggattgacaggcgtttacttgttttgtgttgtttctttggcgacttcggtcaaaagggaagcttctacaattcaagtatagcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatatgaacgaaagaatcccgcctgtgcttgtggtacgccacgagtacggcttttacgtggatttctaaagttctgaaggcaacgaacgtgaccgcaacctctagttgctcgtctcaagggtattgaactttgggatgtcttttgggatatcttgagggatttcccttactcgcacgatgctaactagagggaccgctagtaactttcaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagcatctctcccattgtatgtcttcctctctttattcctttattgggataggaggaacgacaccacgttcactgccgcgtttcggtgtactttgactctccttctcacttttctttgttctcttgcgtgctttcttcttttcaaaccttgatatcctttttttagggtattgagtgtgcgagaagtcgtatagtgtgtgagtagggcggaactgtgggtttaaggcgtcagtcgctgaatgtgttggtctgtgtaacgtgtcgacctacttcgaaagtgtttaggcaatcacttagaagtaacaacccagtttcccgccactttatacatctcttgttttgctgctccctttgcgatactcttcggatgtgtccttggggtttacatgtagccttgatgatgttgtgctccattaattcgttgtggggacagaccattgctaattgttggtctcggtctcaactaggaatgccttgtagatgtggttcaacaaaccgcatcgaatatgtccctgccttttgtacacaccgcccgtcgctcttaccgatggacttcgctgtgagtttgagggactggcaatacagtcatagttaggtcttttcattgaggcctctttggcttgctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI