Specimen 2482

Species Rotaliida > Calcarinidae > Schlumbergerella > Schlumbergerella floresiana
Isolate number 2482
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on February 2001
Location Bali, Indonesia

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Schlumbergerella floresiana | genomic DNA | 2482 | marine sediment sample | taxon:577504 | Indonesia:Bali | Feb-2001 | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttattacataacccgacagtttaaataagtgttacaatgctcactagcttcggacacacacacatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggtatgacacacccactatctacggataactcagggaaagtttggctaatacgtacgagacacacatcacttactcagcactcaatggttatagcaggcgagacacattgagcacggcatatctttggctgagcagactttgcgaagtttacttctgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagactgctcttagttctaaggaacgcagcaggcgcgcaaattgcccaatgctagtaccctacagcatagcactatttattcatgtcacacacatatccttgttcactgtgaggcagtgacaagctgtaacggttgagtataatttatgacgagtgtctggcattgccgctccttcgggagcttggcattgttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcatctcagaacctacggataatttatatattgtctgtgtatctgaattttaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggactgaactgcagatacatatcatatctgtaatactcgacacacggcagacctgatactgatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgttttaactgaatgtgcattgaatgtcttatcatgggatgttgcacccgcacatacacacagttacttgatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactacctaaagcgaaagcagttggctaggctatactccttgtgtcattacacacactgacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatatcacatatgcaaatatcctcaacctacaaaatgacttggcttgagctcgtatcatctgtgatacgctcgccataactattttcgtacggtctcgatggacgtttcattttctctcagcgcgtcggcacacatgtttcgcacacttgattttcggagctttgcgctcaataactggtgagatgtaagcacccacactctccttcgggttcgagtgaacatggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattgattttcgggggtagtatgctcgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccagacacactgaggattgacagattacaatatacagatcttacatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatctgtctgcttaattgcgtttcactgacggctcatatgattttatggtgtgtcgcgtctcagctgatcaccgcatcaatgagccttgaaagcaacgaacgtgaccgcaacctcttgttattaatttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgtgcatctcatacacacacacctaacctatgttaggtacagcctactttgagagggagttaggcaatcaattagaagtaatgattcccatacacagcacacatatatacggcatctttacccggcccgccttgttgcagtgtctctgtgcgtatttgatgtttaccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatgagggaccgatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI