Specimen 334

Species Rotaliida > Calcarinidae > Baculogypsina > Baculogypsina sphaerulata
Isolate number 334
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on December 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgttatcccacataatcagtgggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagtttgtggagtgatctgtctgcttaattgcgtttcactgaaggctcatattatatgcacggcattctttgacccctcattaataatgagcgttgtgtcttagtcttttgcttagcatctgggccttggaagcaacgaacgtgaccgcaacctcttgttgcctctcataaccatataaaagaggcctatttaaataaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatacacatacacaccgcatgcgcgagtccactttttcacgaaggtgtgtgtctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccatacagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacc

See sequence on NCBI

Other sequence

SSU total

>Baculogypsina sphaerulata | genomic DNA | 334 | marine sediment sample | taxon:212455 | Japan:Okinawa, Sesoko | Dec-1996 | 18S rRNA | 18S rRNA | 18S ribosomal RNA | unknown ctcaaagattaagccatgcaagtggttatatattaacccgacagtttaaataagtgttaaagtgctatacacactcacacgtgataatcacatacatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcaccctacacacggataactcagggaaagtttggctaatacgtacgacacacacacacacacatgacattactcagcactcaatggttagcttagcaggcaacatgagagacattgagcacgcactgatatcatacactgtatcacgctgagcagactttgcgaagtttacttctgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaggagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatggtaacacatttatctgtcacgcacacacacacacatccttgtcacgtactgaggcagtgacaagctgtaacggttgagtataaaatatgacgagtgtctggcattgccgctccttctgggagcttggcattattgccgacgctttgtatgctcaattggaatgcggtgagtttaagcaactcagaacctttgtacatatcacatgtgcatannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttactgaatgtgcattgaatgtctatcatgggatggtgcactattcagcccgttgaacacacacacacaataattctcagtcacacaacggttatgaatgtcgatggagatagtggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgtctcactcacacacacacacacactcacacatacacacacagagtgatcgacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattctttttataagattgcaagcactcctcaacctacaaaatgacttggcttgagcctgtaacttttgttgttacgctcgccagactattttcgtacggtctcgatggacgtttcattttattatctatgcgtgtaagcatttgtatgtatcacacatactgcgtgcacttgattttcggagctttgcgctcaaattctggtgagatgtaagcactatgtttatctgttaaccgcagtatgaacaatatttggtgtgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacattgatttccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgttatcccacataatcagtgggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagtttgtggagtgatctgtctgcttaattgcgtttcactgaaggctcatattatatgcacggcattctttgacccctcattaataatgagcgttgtgtcttagtcttttgcttagcatctgggccttggaagcaacgaacgtgaccgcaacctcttgttgcctctcataaccatataaaagaggcctatttaaataaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatacacatacacaccgcatgcgcgagtccactttttcacgaaggtgtgtgtctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccatacagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacc

See sequence on NCBI