Specimen 335

Species Rotaliida > Calcarinidae > Calcarina > Calcarina hispida
Isolate number 335
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on December 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccgaacacactgaggattgacaggtattatccagttacagttacactctaactggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcccatattttaacgcatgttattgcggcgctttgacccctcattaatttgagcgttgtgtcttagtcttttgcttagcaatcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcgtaccaatgtgcaatttctattgtacaaaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttattacacaccgcatgcgcgagtccattttttcggttcgccgcttaaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttattcgcacacatatatacggcatctttacccggcctgccttgttgcagtgtctctgtgtgtattgatgtgattgttattcaatcaattatccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaacccgttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Calcarina hispida | genomic DNA | 335 | marine sediment sample | taxon:203399 | Japan:Okinawa, Sesoko | Dec-1996 | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatcttaacccgacagtttaaataagtgttaaaatgctattcacacattaatagtaacaacatagtgataattcatatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacatacacacaatatgtgatttctctgtatcgcacttatcttataaggacttgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtatttatcacacacatcactcactactcagcactcaatggtaaactttggttacattcgttcgcgattgtgccagtttaaaagtttaactgcaacatgagagacattgagcacgcactgtgcgatttatcgcgcaattcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcacgtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaattttatttattgtattattacgcgttaacaacaatttacctacacacatagcannnaanncatttattcgtgtcacacacacacacatccttgttaactgatatcaatacgtaaatatttatttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgtactggtgttatgaattaatttcactgtgcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaatcactcagagtttattctctttgcgtttgtatctcgacgctataaccatattattattacgcacgtaataatttccacacacgcaccacgcatcgatacgctacagagaatttattctctcacactttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactattcagcctgttggaaattcacattacacgcacacacaataataatttcacaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactacctaaagcgaaagcagttggctaggctatactctttgtctcactctataatcacacacacatacacacacagagtgacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttttaataaaatttgcaaatctcctcagccgacaaaatgacttggcttgagctcgtaacttttcttgttacgctcgccacactattttcgtacggtctcgatggacgtttcattttattctatttttgcgtgtaagcattgttattattctttgaaacataagaattttactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtttattgttacccgcagtatattcctttgggaattttacttgtcgtgttctgtaactaaacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattgatttccgggggtagtatgctcgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccgaacacactgaggattgacaggtattatccagttacagttacactctaactggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcccatattttaacgcatgttattgcggcgctttgacccctcattaatttgagcgttgtgtcttagtcttttgcttagcaatcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcgtaccaatgtgcaatttctattgtacaaaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttattacacaccgcatgcgcgagtccattttttcggttcgccgcttaaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttattcgcacacatatatacggcatctttacccggcctgccttgttgcagtgtctctgtgtgtattgatgtgattgttattcaatcaattatccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaacccgttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI