Specimen 336

Species Rotaliida > Calcarinidae > Calcarina > Calcarina gaudichaudii
Isolate number 336
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on December 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Calcarina gaudichaudii | genomic DNA | 336 | taxon:203401 | 21 | Japan: Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgttatcccaattcacactgaattgggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggccatcattataacgcatgtattgcggcaactttgacccctctgattatttgagcgttgtgtcttagttttttgcttagcatcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcatatacataaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattatacacaccgcatgcgcgagtggcgattatttatttataatcatgcatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctatattcagcacacatatatacggcatctttacccggcctgccttgttgcagtgtctctgtgtgtattgatgttaacttccgtatgtgcaattgtcaattcacggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacacaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatattatttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI