Specimen 339

Species Rotaliida > Calcarinidae > Baculogypsinoides > Baculogypsinoides spinosus
Isolate number 339
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on December 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Baculogypsinoides spinosus | genomic DNA | 339 | taxon:203395 | 36 | Japan: Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccgaacacactgaggattgacaggtagtatcatatcacacacttttgtgttgtgatatgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggccatattttaacgatgtattgcggcgctttgacccctcattaatttgagcgttgtgtcttagtctttgcttagcatcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcataccaaatgcactacactcatgtgttatgcacaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattacacaccgcatgcgcgagtctgattattcactctcgagtgctttaatcatgtagctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttattcgcacacatatatacggcatctttacccggcctgccttgttgcagtgtctctgtgtgtattgatgtgatatattacatatcaattatccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggattgcgttatttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI