Specimen 12249

Bolivina skagerrakensis_12249 Bolivina skagerrakensis_12249
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12249
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12249 | taxon:673208 | 1 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA cgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacatacgttcgcgcgtgtgtgtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatatattctcggatatatcgagtctttctctctacgcgcgattaagnctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagnncattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccnnccggaataaatnncccnccccctttgnacacnccncccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgaactcgcgtatcatattaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12249 | taxon:673208 | 2 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacatacgttcgcgcgtgtgtgtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttttactcacatcgcatgcgtgagtaattttctcatatattctcggatatatcgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgaaactcgcgtatcatattaggaaacttaaaaaaacagtgtggtctaaaggaaagagaagtcgaacaaggc

See sequence on NCBI