Specimen 12250

Bolivina skagerrakensis_12250 Bolivina skagerrakensis_12250
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12250
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12250 | taxon:673208 | 4 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatctcatatgttctgcgtgtgaggtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatcataccctcggatatgacgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactgcctgtgatattcgcgtatcatattaggaaacttaa

See sequence on NCBI