Specimen 13112

Bolivina variabilis_13112
Species Rotaliida > Bolivinidae > Bolivina > Bolivina variabilis
Isolate number 13112
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on November 2010
Location Mediterranean Sea, Porquerolles, France

Barcode sequences

SSU partial

>Bolivina variabilis | genomic DNA | 13112 | marine sediment | taxon:212447 | 1 | France:Porquerolles | 18S rRNA | 18S rRNA | 18S ribosomal RNA cacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaacatcacacgtattcgtacgtgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattggatctatataccgtgcatgtgttgcggcattgacccctcagtatatctcatattgagtgcgcgtctttcgcttagctcactgcgctttagatcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcatacccaatgcgggcaatatacactcgtatatatagttcgcataagaaagcttattattatacacaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttttactacaccgcatgcgcgagtctatttattcttcggtctaaatacgatctctgcgcgcggtaaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctattttttttctgcacacatatatgtggcgcatctacccggcttgccttgttgcaagttctttgtgcgtagatgtgtaccttttccacatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtcattggcgcttatattacgcttcggtgtgatatacgccattctaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Bolivina variabilis | genomic DNA | 13112 | marine sediment | taxon:212447 | 2 | France:Porquerolles | 18S rRNA | 18S rRNA | 18S ribosomal RNA agggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaacatcacacgtattcgtacgtgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattggatctatataccgtgtatgtgttgcggcattgaccccccagtatatctcatattgagtgcgcgtctttcgcttagctcactgcgctttagatcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcatacccaatgcgggcaatatatactcgtatatatagttcgcataagaaagcttattattatacacaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttttactacaccgcatgcgcgagtctatttattcttcggtctaaatacgatctctgcgcgcggtaaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctattttttttctgcacacatatatgtggcgcatctacccggcttgccttgttgcaagttctttgtgcgtagatgtgtactttttccacatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgtcattggcgcttatattacgcatcggtgtgatatacgccattctaggaaacttaaacgncngtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI