Specimen 12268

Globobulimina turgida_12268 Globobulimina turgida_12268
Species Rotaliida > Incertae sedis > Globobulimina > Globobulimina turgida
Isolate number 12268
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequences

SSU partial

>FR754376 AAGGGCACCACAAGAACGCGTGGAGCNTTTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCGGACACACTGAGGATTGACAGGCAATATTAATAATTTATTTTTTCTGTGTGTCACCACATCAGTAATATATTTTATTATGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCTGTCTGCTTAATTGCGTTTCACTAAGGGCCTAGAAATTTACGTATGTTGCGACACTTTGACCCCTCCTTGTGTGCGTGCGTCTTTGTTTGTTTAGCTCATACAAATAGGTCCTGAAAGCAACGAACGTGACCGCAACCTCTTGTTGCTTTCGTATATATATGATACATGTATTTTATTATACTAGTATTAATATATTATACATATTGCTATATATAATATTATGTGTCATTGCCACTAACCTGGTAGTGTCTACATATTTTGTATATAATTTATGCACAGAAAGCTTTTTAAACTAGAGGGACCGCTGTTACTTTCTTAAACCAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTATTATTCACACCGCATGCGCGAGACCATTTATTCTCTCTTCGCGAGTGTTTTAAATGTGTATCTCTGCGCGCGGTAAAGCCTACTTCGAAAGTAAGCGGGTAATCAATTAGAAGTAATGATTTCCTATATTTTATTGTACTGAATTTTTTTGGTATAGTAATTCTGCACACATATATACGGCATCTTTACCCGGGTAGCCTTGTTGTTACTTTTTGTGCGTATCGATGTTTTTTTCCGTATGTGCGATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGAACGCATGTAATAAATTTACGTTTATTTATGCACACCTATGGAAACNTAAACGAACAGTGTGGTCTAAAGGAAAG

See sequence on NCBI

SSU partial

>FR754377 AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCGGACACACTGAGGATTGACAGGCAATATTAATAATTTATTTTTTCTGTGTGTCACCACATCAGTAATATATTTTATTATGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCTGTCTGCTTAATTGCGTTTCACTAAGGGCCTAGAAATTTACGTATGTTGCGACACTTTGACCCCTCCTTGTGTGCGTGCGTCTTTGTTTGTTTAGCTCATACAAATAGGTCCTGAAAGCAACGAACGTGACCGCAACCTCTTGTTGCTTTCGTATATATATGATACATGTATTTTATTATACTAGTATTAATATATTATACATATTGCTATATATAATATTATGTGTCATTGCCACTAACCTGGTAGTGTCTACATATTTTGTATATAATTTATGCACAGAAAGCTTTTTAAACTAGAGGGACCGCTGTTACTTTCTTAAACCAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTATTATTCACACCGCATGCGCGAGACCATTTATTCTCTCTTCGCGAGTGTTTTAAATGTGTATCTCTGCGCGCGGTAAAGCCTACTTCGAAAGTAAGCGGGTAATCAATTAGAAGTAATGATTTCCTATATTTTATTGTACTGAATTTTTTTGGTATAGTAATTCTGCACACATATATACGGCATCTTTACCCGGGTAGCCTTGTTGTTACTTTTTGTGCGTATCGATGTTTTTTTCCGTATGTGCGATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGCCCCTGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGAACGCATGTAATAAATTTACGTTTATTTATGCACACCTATGGAAACTTAAACGAACAGTGTGGTCTAAAGGAAAGAGAAGTCGAACAAGGCA

See sequence on NCBI