Specimen 12270

Globobulimina turgida_12270
Species Rotaliida > Incertae sedis > Globobulimina > Globobulimina turgida
Isolate number 12270
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>FR754378 AAGGGCACCACAAGAACGCGTGGAGCTTTTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGCAATATTAATAATTTATTTTTTCTGTGTGTTTTAACGCACATCAGTAAT ATATTTTATTATGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGT TCGTGGAGTGATCTGTCTGCTTAATTGCGTTTCACTAAGGGCCTAGAAATCTACGTATGTTGCGACACTT TGACCCCTCCTTGTGTGCGTGCGTCTTTGTTTGTTTAGCTCATACAAATAGGTCCTGAAAGCAACGAACG TGACCGCAACCTCTTGTTGCTTTCGTATATATATGATACATGTATTTTATTATACTAGTATAATATATTA TACATACTGCATACATAATATTATGTGTCATTGTCACTAACTAAAAATATAAGACTTGTCTTTTTTTTTT ATGTTGTGTAGTGTCTTTACATATTTTGTATATCTTTATGCACAGAAAGCCTTTTAAACTAGAGGGACCG CTGTTACTTTCTTAAACCAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGC TGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTATTATTCACACCGCATGCGCGAGACCA TTTATTCTCTCTTCGCGAGTGTTTTAAATGTGTATCTCTGCGCGCGGTAAAGCCTACTTCGAAAGTAAGC GGGTAATCAATTAGAAGTAATGATTTCCTATATTTTATTGTATCATTTTTTTGGTATAGTAATTCTGCAC ACATATATACGGCATCTTTACCCGGGTAGCCTTGTTGTTACTTTTTGTGCGTATCGATGTTTTTTTCCGT ATGTGCGATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTGGTCTCGGTCTTAACTAGGAATG CCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCG CTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGAACGCATGTAATAAATTTTATTTATTTATG CACACCTATGGAAAC

See sequence on NCBI