Specimen R6

Liebusella goesi_R6 Liebusella goesi_R6
Species Textulariida > Incertae sedis > Liebusella > Liebusella goesi
Isolate number R6
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Liebusella goesi | genomic DNA | R6 | taxon:944431 | 4 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttnntttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatatatattaaaaaatttattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacctctctgtgagtttgagggactgggtattgatcaaaattaatttattttaatttttctaccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

SSU partial

>Liebusella goesi | genomic DNA | R6 | taxon:944431 | 5 | Norway:Oslo Fjord, 157 m depth | Sep-2010 | Roberto Sierra | Elisabeth Alve | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatatatattaaaaaatttattttttaattatgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttataaatttacgtgtgttgtgagtactttgacccctacgttgaaatattacgtagtgcgcgtcttagtttgcttcacacacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttaatacacaaaaactttagtcatatattatatttttaatatatttatgtattattgtttaaaaaaaggcttttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccaattattggcattcctttagtgtttgcactttaattgtgtttactttgcgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccaatttatagcacacatatatacggcgtctttacccggaataagcttgtcttattttttgtgtgtattgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtattgatcaaaattaatttattttaatttttctaccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI