Allogromia sp. 1

Order “"monothalamids"” > Family “Clade M” > Genus “Allogromia

Original description of genus Rhumbler, L., 1904, Archiv f. Protistenkunde, Jena, Deutschland, 3, p.203
Description of genus Loeblich, A., J., R., Tappan, H., 1988, vol.1-2, Van Nostrand, Reinhold, New York
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Sphaerical orange coloured cell with thick proteinaceous wall and terminal aperture.

Representative pictures

Allogromia sp. 1 Allogromia sp. 1

Specimens

Specimen 12957

Allogromia sp. 1_12957
Species "monothalamids" > Clade M > Allogromia > Allogromia sp. 1
Isolate number 12957
Collector Jackie Guiard
Identifier Jan Pawlowski
Collected on October 2010
Location Cyprus

Barcode sequence

SSU partial

>Allogromia sp. 12957 | genomic DNA | 12957 | taxon:944415 | 5 | Cyprus | Oct-2010 | Jackie Guiard | Jan Pawlowski | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctgngnattgagaggtttttataagactatatataattatttttaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactttaatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaacgaacgtgaccgcaacattttgttgcataatcttatttatgctaactaaatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggattatattaatccgcaggaattattaaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggtaatcaattcgaagtaatgatttccttttgcacaataataatattttattctattaatcttaatctttatgattttgtattaaagttaaaatatgtgctcctttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccaggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacaggacgggaactctattcatttttaatgattgagttctataagaantacgcgaacagt

See sequence on NCBI

Specimen 12958

Allogromia sp.1_12958
Species "monothalamids" > Clade M > Allogromia > Allogromia sp. 1
Isolate number 12958
Collector Jackie Guiard
Identifier Jan Pawlowski
Location Cyprus

Barcode sequences

SSU partial

>Allogromia sp. 12958 | genomic DNA | 12958 | taxon:944416 | 7 | Cyprus | Oct-2010 | Jackie Guiard | Jan Pawlowski | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctnnnncttgacaggtttttataagactatatataattatttttaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactttaatgagtatatattgaatactttgtttgcacataaaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaacgaacgtgaccgcaacattttgttgcataatcttatttatgctaactaaaatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggattatattaatccgcaggaattattaaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggcaatcaattcgaagtaatgatttccttttgcacaataataatattttattctattaatcttaatctttatgattttgtattaaagttaaaatatgtgctcctttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccaggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctggagtatacaggacgggaactctattcatttttnnnattgagttctataagaatgtacgcgaacagnnnntctnnnaaagagaagtcgaacaaggcaaagggcgaattcgtttaaaccngcagggac

See sequence on NCBI

SSU partial

>Allogromia sp. 12958 | genomic DNA | 12958 | taxon:944416 | 8 | Cyprus | Oct-2010 | Jackie Guiard | Jan Pawlowski | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctgaggcttgacaggtttttataagactatatataattatttttaattatatatagcaattcatatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactttaatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggnattttttaaaatatactctgaaggcaacgaacgtgaccgcaacattttgttgcataatcttatttatgctaactaaatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggattatattaatccgcaggaattattaaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggtaatcaattcgaagtaatgatttccttttgcacaataataatattttattctattaatcttaatctttatgattttgtattaaagttaaaatatgtgctcctttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccaggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacaggacgggaactcnnnncatttttaatgattgagttctataagaat

See sequence on NCBI

Specimen 12959

Allogromia sp. 1_12959 Allogromia sp. 1_12959
Species "monothalamids" > Clade M > Allogromia > Allogromia sp. 1
Isolate number 12959
Collector Jackie Guiard
Identifier Jan Pawlowski
Collected on October 2010
Location Cyprus

Barcode sequence

SSU partial

>Allogromia sp. 12959 | genomic DNA | 12959 | taxon:944417 | 9 | Cyprus | Oct-2010 | Jackie Guiard | Jan Pawlowski | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctcttnattgacaggtttttataagactatatataattatttttaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactttaatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaacgaacgtgaccgcaacattttgttgcataatcttatttatgctaactaaatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggattatattaatccgcaggaattattaaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggtaatcaattcgaagtaatgatttccttttgcacaataataatattttattctattaatcttaatctttatgattttgtattaaagttaaaatatgtgctcctttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccaggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacaggacgggaactctattcatttnnaangattgagttctataagaatgtacgcgaacagtnnnnncnnnnnanaagagaagtcgaacaaggcaaagg

See sequence on NCBI