Dendritina zhengae

Order “Miliolida” > Family “Peneroplidae” > Genus “Dendritina

Original description Hatta, A., Ujiie, H., 1992, Bull. Coll. Scie. Univ. Ryukyus, 49-119
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Description Hohenegger, J., Yordanova, E., Nakano, N., Tatzreiter, F., 1999, Mar. Micropal., 109-168

General description

D. zhengae has an evolute planispiral test that becomes uncoiled in later portions. The aperture is dendritic. Living specimens are distinguished by a purple colour due to rhodophycean endosymbionts.

Representative pictures

Dendritina zhengae Dendritina zhengae

Specimens

Specimen 322

Species Miliolida > Peneroplidae > Dendritina > Dendritina zhengae
Isolate number 322
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on November 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgataggattattatatttataataattcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatagtattatatattgttactaacataatattgtgcatcctatatatattatataggattttaagtgaacatattatattatgtattacatatatatatatattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataacgtatagtatagcataaaattaaaggaaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatttatatatatattaattctaatatattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattacttattatactacattttcttggtagtattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatataagggacataaacattatataatattgaaacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Dendritina zhengae | genomic DNA | 322 | taxon:128063 | Japan: Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacgttatttcaaataatatattatatatatttggataactaagggaaagtttggctaatacatatgtcttattgcatataatggttaatatatgattaacattatataaatattatgtacttttgtacaatttatagagcagactttatataattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgatatatattaccttgtatacttactcaatatgtatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcgctttgtataatttattatacattgcttgataatataccaatgttataaaatattgaatttgaatgcggtgattctaataatttcaagtaacatgtatattatatgttatctgaatattcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcctatacaatcattgttgcggttaagaggctcgtagttggattgaataatgaatatacatacataatactgtgaacaaaccagagtgtataaaacatgtaataaataattattattagcaatgaatgttttatcatgggatattgcaataatatttcgatggagatagttggagttgagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactctttgtatattccatagcaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaataaacatgaatgtttataatccttcaatatatattatacatttatagttgagttataagttataactcctataatatatattattaatattgaatttttaaatattttcataatatatatgattatatgtactttgcgctcatatatttattccggtgagatgtaagcattataggagagtaatattacacatctgtaattattataatcctaatttaaaaacgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaatagtaccctcctggggtagtatgcacgcaagtgtgaaactnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccggacatattgaggattgacaggcgataggattattatatttataataattcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatataattatataatagtattatatattgttactaacataatattgtgcatcctatatatattatataggattttaagtgaacatattatattatgtattacatatatatatatattatatattaaaatgaatgcaacgaacgtgaccgtaaccttttattgctataacgtatagtatagcataaaattaaaggaaccgctgtctaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatttatatatatattaattctaatatattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattacttattatactacattttcttggtagtattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatataagggacataaacattatataatattgaaacttacatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI