Toxisarcon alba

Order “"monothalamids"” > Family “Clade C1” > Genus “Toxisarcon

Original description Wilding, T., A., 2002, J. For. Res., 32, 358-363
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

The cell is free, large, and irregular with a central inflated region from where branches extend in all directions. A test has never been observed. On the seabed, the presence of T. alba is indicated by a distinctive, slightly raised, approximately circular mound of 18–40 mm diameter through which there are many perforations. Reticulopodia are occasionally seen at the base of the perforations.

Representative pictures

Toxisarcon alba Toxisarcon alba Toxisarcon alba

Specimens

Specimen 2281

Species "monothalamids" > Clade C1 > Toxisarcon > Toxisarcon alba
Isolate number 2281
Collector Tom Wilding
Identifier Tom Wilding
Habitat soft sediment
Location Scotland, Loch Linnhe
Latitude, Longitude 56.3205, -5.2725

Barcode sequences

SSU partial

>Toxisarcon alba | genomic DNA | WC18H | taxon:164134 | 12 | single cell | United Kingdom:Scotland | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgacccaacgcgggaaatgttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagctttttgactagaattttttgattttagttttaagaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggacattttgccttgttctttgcatttgagttgcttttagtgagttttaacgtttttagtttgttttaccccagtttcggctgcgcgcgtaactttcttttttaaactattgcttcaagttttaatttatttgtgaggggctcatggtgaaattctgctatttattgggagaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaactattaagctttaaatttcttttttcattaagagatttttttagccagttttaacaaagtaggctctattctcttcattaaaaacaggggaataaaactaaagggaccgctgcgactttttttaaaccagagaaggttgcggcaataacaggtctgtgatgcccttagatgattccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgttatttatagatttttcgtagctttcttttttctatatggactttattgtctgtgtggagaggggaaggttatggatattttacaatcagtaaattccagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttatatcaaaatttattttttggttttgcgagcacacaatgtgctgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttcctgactttttttataaacaaaaaaacaaggaatttacagtgcgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctttgtcggttaggcggtttttattaactgcttctgacactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcngtaggtgaacct

See sequence on NCBI

SSU partial

>Toxisarcon alba | genomic DNA | WC18H | taxon:164134 | 11 | single cell | United Kingdom:Scotland | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccaccaggagtggagtctgtggcttaatttgacccaacacgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaacagccttttgactagaatttttttattttagttttaagaggcgttctcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcaatggacttaataacaagttgcgctcttcttttctttgtggacattttgccttgttctttgcatttgagttgcttttagtgagttttaacgtttttagtttgttttaccccagtttcggctgcgcgcgtaactttcttttttaaactattgcttcaagtttttaatttatttgtgaggggctcatggtgaaattctgctatttattgggagaggattagtgcacattgagtcctgaaagcaacgaacgtgaccgcatccttttgttgccttctaactaaactattaagctttaaatttcttttttcattaagagatttttttagccagttttaacaaagtaggctctattctcttcattaaaaacaggggaataaaactaaagggaccgctgcgacttttttaaaccagagagttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcatttcaaaaacgctgttatttatagatttttcgtagctttcctttttctatggactttattgtctgtgtgagaggggaggttatggatattttacaatcagtaaattccagcttagcctgcttcgaaagttagcaggtaatcacttggaagtaatgatttcccttatatcaaaatttattttttggttttgcgagcacacaatgtgctgctctctgtcttgcttgggtagcaattacgtctactttttagctatacggcagagatgttcctgactttttttataaacaaaaaaacaaggaatttacagtgcgtgctttttgtcaattcatggtggggacagaccattgttaattattggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagctttgtcggttaagcggtttttattaactgcttctgacactataaacacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcngtaggtgaacct

See sequence on NCBI