Notodendrodes hyalinosphaira

Order “"monothalamids"” > Family “Clade F” > Genus “Notodendrodes

Original description DeLaca, T., Bernhard, J., M., Reilly, A., Bowser, S., S., 2002, J. For. Res., 32, 177-187
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Coarsely agglutinated rounded test with allogromiid foraminiferan inside.

Representative pictures

Notodendrodes hyalinosphaira

Specimens

Specimen 1225

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes hyalinosphaira
Isolate number 1225
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes hyalinosphaira | genomic DNA | 1225 | taxon:159871 | 19 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttcatatggtattgtatcaatgcgtttttcctttttggagaaatgtacatatgtactattatgcaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatggctcgtacgtgttttatgctaatactgtgacctcattgttcttttacagagtggtgactgcgtccggtatggtatacgctgcgatcgccacgaaggcaacgaacgtgaccgcagcctcttgttgcctcccatgtgcaaactgcattgtatttctgcgtgttgtactttagggtataatatgtgttatgctttcggtttttgccacagttttttcacttgtattcatttcgtatatctttggtgatttgcgaagactacttggatttatatttgtgttatgtggtcgcttcaaatgcggctatgtacacttttgtattttccttgtatgtctctctgttgcttttgagatatatttgtttatgtgtacatcgaaattatctgcagtggagggaaactagagggaccgctgactctttataaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctacccagttcgtgtgcacagtttttcgttacattaatactttaaagggtatatattatgcatgtgttggtggcgtctttcgctagatgccctgatatgtgtgtgtgttgcctgttagtgttagcgggctgatgcatttttacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttcctttgcatattttatatatgtcctgtattttatgggtgttttctcttttcagagtttacgtctccgtattattcagtggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaaactccttttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 343

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes hyalinosphaira
Isolate number 343
Collector Sam Bowser
Identifier Sam Bowser
Collected on December 1996
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes hyalinosphaira | genomic DNA | 343 | taxon:159871 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttcatatggtattgtatcaatgcgtttttcctttttggagaaatgtacatatgtactattatgcaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacatatggctcgtacgtgttttatgctaatactgtgacctcattgttcttttacagagtggtgactgcgtccggtatggtatacgctgcgatcgccacgaaggcaacga

See sequence on NCBI