Notodendrodes antarctikos

Order “"monothalamids"” > Family “Clade F” > Genus “Notodendrodes

Original description DeLaca, T., E., Lipps, J., H., Hessler, R., R., 1980, Zool. J. Linn. Soc., 69, 205-224
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Large agglutinated arborescent foraminifera with a dendritic root system.

Representative pictures

Notodendrodes antarctikos, photo courtsey of Sam Bowser

Specimens

Specimen 1082

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes antarctikos
Isolate number 1082
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes antarctikos | genomic DNA | 1082 | taxon:162490 | 6 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttgatgcagtacttatatcaatgctttttgttgctttggcagcggtttaattatcgttgtttttgtagtggggagtacatatgtgccgtattacaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatggcacgcatgtgttttatactaatactgtgacctcattgtttttttacaaagcagtgactgcgtccggtatggtatgcgctgtgatgcctcgaaggcaacgaacgtgaccgcagcctcttgttgcctcccttgtgcatgctgcattgtgttttgtggtagtgttttcatttttaatgaattcgccatgttacgctttcagttttgccacagttttttcaactgtatgtattatcttatgcctgtntggtgttttagagttgcactatgcgtatgtggttgctacaaatggtgatcgtgtgcgtttgtgtgacatcttggcgctgcttttagggtatattgcatgtgcgtacaaagaatttatctgcagtggagggaaactagagggaccgctgactttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatcttacccagttcgtgtgcacagtttcagttacactgatactttaaagggtattggttgtgtgttgaaggttttgcctttatacgcatggcttttacctgttggtgttagctggctgatgcatttttacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttcctttgcatatnttatatatgtcctgtattttaaggctgttttctcttttagagattacaatttacctctattatacggtggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcgttttcaactaggagtgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttcactgtgagtttgagggactggaaaccctttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 340

Species "monothalamids" > Clade F > Notodendrodes > Notodendrodes antarctikos
Isolate number 340
Collector Sam Bowser
Identifier Sam Bowser
Collected on December 1996
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Notodendrodes antarctikos | genomic DNA | 340 | taxon:162490 | single cell | Antarctica:Explorers Cove | 18S rRNA | 18S rRNA | 18S ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggtgtttcgttttgatgcagtacttatatcaatgctttttgttgctttggcagcggtttaattatcgttgtttttgtagtggggagtacatatgtgccgtattacaaaacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatggcacgcatgtgttttatactaatactgtgacctcattgtttttttacaaagcagtgactgcgtccggtatggtatgcgctgtgatgcctcgaaggcaacga

See sequence on NCBI