Oridorsalis umbonatus

Representative pictures

Oridorsalis umbonatus, spiral side, Arctic specimen Oridorsalis umbonatus, spiral side, Antarctic specimen

Specimens

Specimen 5149

Species Rotaliida > Incertae sedis > Oridorsalis > Oridorsalis umbonatus
Isolate number 5149
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Oridorsalis umbonatus | genomic DNA | 5149 | seawater, depth:2167m | taxon:331062 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggatctatcaatacgtgtgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcgcttcggtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggatcgcagatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5164

Species Rotaliida > Incertae sedis > Oridorsalis > Oridorsalis umbonatus
Isolate number 5164
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Oridorsalis umbonatus | genomic DNA | 5164 | seawater, depth:4407m | taxon:331062 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggatctatcaatacgtgtgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcgcttctgtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggatcgcagatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5410

Species Rotaliida > Incertae sedis > Oridorsalis > Oridorsalis umbonatus
Isolate number 5410
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2005
Depth 2462.4m
Location Arctic Ocean, AWI Hausgarten
Latitude, Longitude 79.3, 4.1

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagaatctatcaatacgtgcgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggttctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcacttcggtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactgggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggggatcgcggacgatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

SSU total

>Oridorsalis umbonatus | genomic DNA | 5410 | J. Pawlowski 5410 (UniGE) | taxon:331062 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttactccatcacgcacaacacatgattttgtttacagtagtaacaatttcagcgtgagtcacctcagcagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcaataaaaaatttcattcgacacctgttcgcgcaggcagacggtggatttttttattttgttgcatcacgcatacaaaatttttttgatttctctgtatcgcttattctcaaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtaatctacctcacacacacacacactcacgcacacaattcaaaaattattttgttttgccgtgtrtcgactatacatttcactactcagcactcaatggtaaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgttcctttgggaacttcacatcgcgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtattttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacataacaagtttatcacacacacatataacactatattttttctgttacccatacagaattttctattctggacatccttgttcgttgttttattcagcataaataatatatctccaattttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgcttygtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagtggagggcaagtctggtgcnnnnnnnngcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatatgaatgaattctcatcattcagtttgaaagttttacgcgttggaatcaaatttatttgatttctcagcgcgttcgacgctgttaaaatttttacaatttacactgtattaattttttttaccaacggcacaaattttttctgccgcatatatttttactcacacacactcataacccacacaatatatgcatcacacgcgggaaatctttggaactcattcactcatagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcgccttaaaaaaattttactgcattacgtgccgtacatatttttttatacacacacacgcatacgcacatgtttacatagccacgtaaaaatttttatcaacggtaatttttttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattataatgtattcgcgctatttcttcacacacacacgcaaaaagttttagcgcacacagtacatattatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcttacaaaataacttggcttgagctcgtatttttatacgctcgcctaatttttttcgtatagtctcgatggacgtttcatttattattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcattgtgtcatactgcccgcagcgtatagtctcggctatttcgtctgtcgtgtgtagttgacaatcttgatgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgtttcggcgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagaatctatcaatacgtgcgttgcggcactttgacccctctctgagcgcgcgtcttagttgcttagctcgcacaattaggttctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatttttgctgttctcagcattaatgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttttacacaccgcatgcgcgagtccgtttattcacttcggtgttttaaacgtgtatttctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaacgatttcctttagcacacatatatacggcgtctatgcccgggttgccttgttgtaacttctgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactgggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggggatcgcggacgatttatctgcacaacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI