Conqueria laevis

Order “"monothalamids"” > Family “Clade CON” > Genus “Conqueria

Original description Gooday, A. J., Pawlowski, J., 2004, J. Mar. Biol. Ass. U.K., 84, 919-924 (270 KB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

The test is elongate, tubular, with a smooth outline uninterrupted by irregularities apart from slight fluctuations in width. There is a single terminal aperture.The test is usually more or less straight or slightly curved, occasionally more strongly curved or following asinuous course. It ranges from 340 to 1400 mm in length and 50 to 100 mm in width.

Representative pictures

Conqueria laevis Conqueria laevis, holotype

Specimens

Specimen 3409

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3409
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3409 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA aatcttaccgggtccggacacactgaggattgacaggcgcttgtagttatgagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttataatagtgtgtgcacgcataacttcggttatgttgttgcctactgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttattatcttttttgataattgagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcttaacagattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgtagtaaccttgctttatttatcttttgatttatattgtcttgatttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3437

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3437
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3437 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA ggaaacttaccgggtccggacacactgaggattgacaggcgcttgtagttatgagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttataatagtgtgtgcacgcataacttcggttatgttgttgcctactgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttattatcttttttgataattgagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcttaacagattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgtagtaaccttgctttatttatcttttgatttatattgtcttgatttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3476

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3476
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3476 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA ttaccgggtccggatacactgaggattgacaggcgcttgtagttataagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttaaaatagcgtgtgcgccataatttcggttatgtgctgcctgctgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttataatttaattttattattaaattattaagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttaatatttatattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgatgtaaccttgcataatctctcctttttggagggtgcatgtattgttttgttaccttgggacatgtgctccattaattcttgttggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3477

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3477
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3477 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggcgcttgtagttatgagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttataatagtgtgtgcacgcataacttcggttatgttgttgcctactgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttattatcttttttgataattgagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcttaacagattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgtagtaaccttgctttatttatcttttgatttatattgtcttgatttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 3487

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 3487
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on April 2002
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 3487 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA atcttaccgggtccggacacactgaggattgacaggcgcttgtagttatgagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttataatagtgtgtgcacgcataacttcggttatgttgttgcctactgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttattttattatcttttttgataattgagatcggtttatagaggctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcttaacagattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgtagtaaccttgctttatttatcttttgatttatattgtcttgatttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5412

Species "monothalamids" > Clade CON > Conqueria > Conqueria laevis
Isolate number 5412
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on August 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Conqueria laevis | genomic DNA | 5412 | taxon:1051369 | 1 | Antarctica:Weddell Sea | 18S rRNA | 18S rRNA | 18S ribosomal RNA taccgggtccggacacnctgaggattgacaggcgcttgtagttataagattattaatttattaataattaaatttctgctataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactgtggacattgttaaaatagcgtgtgcgccataatttcggttatgtgctgcctgctgttccaaatgtcctgaaggcaacgaacgtgaccgcaacctcttgttgcctcttccaaatacttatttcataatttttaattattganattggtttatanaggctaactanagggaccgctgacnacttttanaacanangaaggttgcngcaataacangtctgngatgnccttanatgttccgggctgcgcacgtgctacnatgattattgcactgagcatctaattttattaaaagttcgtttggtttaatttgatcattttttgattaaataaaactaacgacatttcctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccacccgcacatactaatgtctcttgatgtaaccttgcataatctctcttttttgagggtgaatgtattgttttgttaccttgggacatgtgctccattaattcttggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggctctctttttgagctatggaaactcaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI