Rhizammina algaeformis

Order “"monothalamids"” > Family “Clade C” > Genus “Rhizammina

Original description Brady, H., B., 1879, Quarterly Journal of the Royal Microscopical Society, new series., 19, 20-63
Revision Cartwright, N., G., Gooday, A., J., Jones, A., R., 1989, J. For. Res., 19, 115-125
Further reference Lecroq, B., Gooday, A., J., Tsuchiya, M., Pawlowski, J., 2009, Zool. J. Linn. Soc., 156, 455-464 (610 KB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

The test wa11 is cornposed of a thin mucopolysaccharide layer overlain by a thicker agglutinated layer. The test lumen is occupied mainly by large accumulations of stercomata (waste pellets), alongside which runs a narrow protoplasmic strand.

Representative pictures

Rhizammina algaeformis

Specimens

Specimen 3213

Species "monothalamids" > Clade C > Rhizammina > Rhizammina algaeformis
Isolate number 3213
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcaatgtgagatttatatctcatattataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcatgggacttataaataagtgtgctacttttcttgtttcgcttttatattttaacttatttataagttatttatgattgcgtttacaattatgaaatgtctgcgcacattaggtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttacttaaacgaacagtcttatttttaataaattcggctgtgagttttaacaaaagagtgctttataaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattataaaacgctgttttattgaccattatgatttattgttttggttgagcagccaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttaaaattcagattttaatttgtctttttgtgaagcacactatatgttgctcccttccctggccgtttgcttttttgtctttcggtctttagtggttgggtgttttttcaacatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagcttttacgttaaactaaaagctacaatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Rhizammina algaeformis | genomic DNA | 156 | taxon:525823 | small subunit ribosomal RNA ctcaaagattaagccangcaagtggntcttacctgacggtttgaataagtgttctcgcatagatttgatcagtttttgttccgttcatttctattctatttctgtcttttttacattgnctcacattcacttgtgcaactgcagatagctgcttaatacagtctcacttgtcttgacttggcattcgtttgctattcacatttcttctttctctctctctctttctaccatgtctgtgaaagcaattttggtgtgttcgcactgttaacacttcctactggataactaagggaaagtttggctaatacgtacgagantcacttttctcttctctcttctctcttctctctctctctctctctctctctctcatttgcacttattggtttgtggaccggatctttttgtatttctggtttcacagtagcctcatgantgacaataagaacgcactaagcaatctttctgagattgttgctgagcagacttgcaatcatctttttgcaagcatgtcatacaagcatctacagcatcaagtcacagngttggcaagtgtctttttgaaccttcaaagcagtcacgcatacggaggagtagtttctgatcccatagaaggagcaccgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgatagcctcttgtggacttatcatcttggacaagataaaacaaaactgattcgaattttccgttgaatgctttttgcnttcgtggtcttattcttcttacttctttctctttctctctctctctcttattctttatttctgtcttgttgacaccttcttgtttgacgatttggactggctcgttcacacgagttggtctgatcctttcattgaggcagtgacaagctgtaanttttgagtatgcttaaagaacgggtgtgtagacactgtcacttcgtgattcgtgactccgccnaatatgtgctcatttggnatgcggtgaatttaagtcattcggagtgagtggtgtccttgtttggacatcacaaacatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaacacttttaatatgaaaacaaattttattctttttaatagaaatagatttgccttttttttattatacgacatacaattttacacacacatttatttttattatcatcattcttttttatttttcaacactgtgaacaaatcagagtgtaccaaacatgtcgttttacgataagtgcattgaatgtttcatcatggaatgttgcacttctaacatttttatatgtatatttttttngtcatttagttacactacacatttggttaacgtggcaataaaaggtatattattataaaaatatgtcgatggggatagttggagtcaagagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcacttgactaggctatactctttgtgaatattttcctttttaaattattacacacactattaattnttttaaatggaaatttcccactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttgttacatcaaacgatgggctctcaattgcatatacttttgaatgctattgccctcaacctgcaaaaattttgtggttcgagcttatgttatatttttatgacacgctcacctatttattttagtacggtttcgacggacatttcatttatatattttttgcgtgtaagtatttttaatattgcttgaaacattagcaatatgtgcctgcacatgattttctgagctttgcgctcatattatttggtgagatgtaagcactagacgtgggctactttcagcggctgtgcgcaggtattaatttatcgccgtagctttgtttgattgttcagcctttcgttattttaatggtgtgaagcacgcgttaggcacgcgcttactgcagaaatgtctgagacattccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcaatgtgagatttatatctcatattataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgcatgggacttataaataagtgtgctacttttcttgtttcgcttttatattttaacttatttataagttatttatgattgcgtttacaattatgaaatgtctgcgcacattaggtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttacttaaacgaacagtcttatttttaataaattcggctgtgagttttaacaaaagagtgctttataaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattataaaacgctgttttattgaccattatgatttattgttttggttgagcagccaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttttttaaaattcagattttaatttgtctttttgtgaagcacactatatgttgctcccttccctggccgtttgcttttttgtctttcggtctttagtggttgggtgttttttcaacatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagcttttacgttaaactaaaagctacaatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI