Textularia sagittula

Order “Textulariida” > Family “Incertae sedis” > Genus “Textularia

Original description Defrance, J., L., M, 1824, 32, Strasbourg: F.C. Levrault
Description Höglund, H., 1947, Zoologiska Bidrag fran Uppsala, 26

General description

Biserial chambers in adult specimens often somewhat inflated. Agglutinated wall, sutures distinct but only slightly depressed.

Representative pictures

Textularia sagittula

Specimens

Specimen 6795

Species Textulariida > Incertae sedis > Textularia > Textularia sagittula
Isolate number 6795
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Location Norway, Bergen

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttattaatttttattaataatatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattactttagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttacaatatacgcgattaaatatttatttattttttcgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgctagcgcgtgtccaattatttgcgtacttttgtgcgtattttaattgtgtacattgtgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccttttatagcacacatatatacggcatctttacccggtttgcgcttgtcgtaaattttgtgtgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtattgtaaaatttattttttacagccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Textularia sagittula | genomic DNA | taxon:551666 | 18S ribosomal RNA tsagtttactcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctactaaaatttatacaacgcgcattgtttacagtagtaacaatttttagcgtgaatcccatcttaagtgattcatactgattatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacgataaaaatatattctttttacacgtttacgcgtaaaagattcattttttattaattttttgctaattacacacacacaaaattacacgcacaaaattaaaaattttgatttctctgtaacgctatctatataagattaattacgttacaccgtgaaaatttctttttggataactcagggaaagtttggctaatacgtacgagttttttttaacctacacacacacacacacacacaattacattcaaaattttttaatattttggtatgttacccctttactactcagcacatattggtaaattttggtttactttgtaaaccagtttaaaatttaactgcaacatgagagacaatatgtacgcacgtataattacttcggtatttatacattacgctgagcagactttgcgaagtttactttgcgaagcaggtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcgcgcatacggaagagtagtttctgatcccatagaaagagcaccgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatttatatgtaattatactaatacacgcattacaatttacaataaacaaaattaatttaaattaattttagctattcattataacacttcaattttactgttaaaattttaaattatccttgttcgttgttactcgtatatttaatatataatattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgtctagttcgctaggcttggcagttcgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgtatggtgtttgtaaaatttcactatgcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacatatataaattaaatttattttaattttgtttgacaagttttacgcacataggtcactaaaaattattaatttttttttgactgttcgacgtgcgttcgacgctgttaaattttataaataaaattttattaattttttttttacacacacaattaattaaaaatttattaaaattttactgtttgccgtataaaatattttatttcaaacacttaaatttaatttacaatttcaacactgtgaacaaatcanagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatggaatgttgcacttttaattttaaaatttactgtattaaaaataatttttttacgcacacacacncacacgcacgtaaaaatatattttgacccacagagtcatgcattgatatataaaatttttattggtaaattttttaacagttaaaaatgtcgatggggatagttggagtcaggagtactgttgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcacttggctaggctatactctttgtgattaaataaaaaaaaaattaattattttaattttacgcacacacacacatacacgcacgtaaaatataataaattaaattttttatttatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacancaaacgatgggctctcaattgcatttatttattaaattgctaatgccctcagcctacaaaataatttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttaaacttttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtcatactatccgcagcgtttatcttcggataatttgtctgtcgtgtatagttgacaatttttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtctgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaatttttattaatttttattaataatatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaaattacgtgtgttgtattgttttttgacccctatcgttgaaatattactttagtgcgtgtcttaaattgcgatactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttacaatatacgcgattaaatatttatttattttttcgtaaaaaaaggcttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgctagcgcgtgtccaattatttgcgtacttttgtgcgtattttaattgtgtacattgtgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccttttatagcacacatatatacggcatctttacccggtttgcgcttgtcgtaaattttgtgtgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtattgtaaaatttattttttacagccacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI