Hippocrepina indivisa

Order “"monothalamids"” > Family “Clade C” > Genus “Hippocrepina

Original description Heron-Allen, E., Earland, A., 1913, Roy. Irish Acad. Proc., 31
Description Höglund, H., 1947, Zoologiska Bidrag fran Uppsala, 26
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Finely agglutinated monothalamous test, colour varies from lustrous grey to rusty brown.

Representative pictures

Hippocrepina indivisa

Specimens

Specimen 4643

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4643
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on July 2004
Habitat soft sediment
Location Svalbard

Barcode sequences

SSU partial

>Hippocrepina indivisa | genomic DNA | 4643 | taxon:1051372 | 2 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatttttttattttcttataaaatatagttcacatataaatgatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataattttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaggtaatgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttgcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccg

See sequence on NCBI

SSU partial

>Hippocrepina indivisa | genomic DNA | 4643 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagccgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatttttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacctgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccaraggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcagtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgtttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccgcccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

Specimen 4645

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4645
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on July 2004
Habitat soft sediment
Location Svalbard

Barcode sequences

SSU partial

>Hippocrepina indivisa | genomic DNA | 4645 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA agggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgnc

See sequence on NCBI

SSU partial

>Hippocrepina indivisa | genomic DNA | 4645 | taxon:1051372 | 2 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccaaagaccgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaanccacccggaatacgtccctgccctttgtacacac

See sequence on NCBI

Specimen 4724

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4724
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on July 2004
Habitat soft sediment
Location Svalbard

Barcode sequence

SSU partial

>Hippocrepina indivisa | genomic DNA | 4724 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaccgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttatttttttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggcctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgagtaccttagtaacttttgttgctataatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 4859

Species "monothalamids" > Clade C > Hippocrepina > Hippocrepina indivisa
Isolate number 4859
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2004
Habitat soft sediment
Location Svalbard

Barcode sequence

SSU partial

>Hippocrepina indivisa | genomic DNA | 4859 | taxon:1051372 | 1 | Norway:Svalbard | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaattttttttattttcttataaaatatagttcacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcatactggacttgaattaaaaaagtgttctatttttcattgtattgttactcatgtgttttcgtgagcgcaaaagttattttgtgtaagcgggcacgtgtggttctttacttttaattgattaatatgtgcacgtctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaataaaaagatttttttcttttttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagttagcatctcattttatagcactgtatctcattttaagttttattatataatttttttatattttgaaattatgagagcagtcaaagcctgcttcgaaagttcgcaggtaatcacttggaagtagtgatttcccttaactcaaacataaataatatttttgtttgttttttttctgagcacacaatatgctgctcctctccctggcatttagctatttttgtctttttgccgctgtgtgtgaggatgttttcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctc

See sequence on NCBI