Gloiogullmia sp.

Order “"monothalamids"” > Family “Clade C2” > Genus “Gloiogullmia

Original description of genus Nyholm, K., G., 1974, Zoon, 2, 157-196
Further reference Pawlowski, J., Majewski, W., Longet, D., Guiard, J., Cedhagen, T., Gooday, A., J., Korsun, S., Habura, A., Bowser, S., S., 2008, Polar Biol., 31, 1205-1216 (652 KB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Test elongate ovate to sausage-shaped, up to 2mm in length. Wall of two more or less separated proteinaceous membranes, single aperture, cytoplasm with numerous inclusions.

Representative pictures

Gloiogullmia sp., Antarctica, New Harbour

Specimens

Specimen 1188

Species "monothalamids" > Clade C2 > Gloiogullmia > Gloiogullmia sp.
Isolate number 1188
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Gloiogullmia sp. 1188 | genomic DNA | 1188 | taxon:164091 | 11 | single cell | Sweden:Tjaerno | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatcatgtgaatcgtttttatcttttaaaacattcgcatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtctcatactggacttagaaatcaagtgtgtttatttttcttgtgcggttatgttttaatgcattttgttaccccatttttttgggtgagtttcaatttgtgttttacattccgtgctttattgataaataaatacacatctagtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttaacttaaaacatttttttttattttttttactttaatttcttgttttataatataagaggctttcttaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacagcactgttttcattttttttttaaaatgagcagtcaaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttcccttaactcaaatttatttttgattttgtgagcacacaatatgctgctcccctccctggcatttagctttttgtctatttgtcattgtgtgtggggatgctcagcatgtgctttttgtcaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtaccttagttttttttattttttttttaatttgaaaaaagctataatcacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI