Bowseria arctowskii

Order “"monothalamids"” > Family “Clade B” > Genus “Bowseria

Original description Sinniger, F., Lecroq, B., Majewski, W., Pawlowski, J., 2008, Polish Pol. Res., 29, 5-15 (229 KB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

The theca is elongate, tubular, often slightly curved and irregu− larly shaped. The apertural (proximal) end is usually wider and more broadly rounded compared to the narrower apical (distal) end. The aperture is single, terminal, small and rounded. It may project slightly but is sometimes retracted and invisible. The cytoplasm is white to yellowish, dense and fluffy with fine granules. It fills the theca almost entirely, sometimes leaving small empty spaces at both ends.

Representative pictures

Bowseria arctowskii Bowseria arctowskii Bowseria arctowskii Bowseria arctowskii

Specimens

Specimen 4026

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 4026
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on June 2003
Habitat soft sediment
Location Antarctica, Ross Ice Shelf

Barcode sequences

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 2 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaattcgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggyttttaagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttattcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgccaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagacatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgtgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggnttttaagtttnaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcancatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcngaaggatca

See sequence on NCBI

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 4026 | taxon:1051355 | 5 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgngtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttctttttatttttttaactttcaagtcttctggcttttcagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7855

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7855
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7855 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatcttttttttttttatttttttaactttcaagtcttctggcttttaagttnnaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7856

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7856
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7856 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatctttttttttttatttttttaactttcaagtcttctggcttttaagttttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttattcgttgtattaaacttcggttttttnctttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7866

Species "monothalamids" > Clade B > Bowseria > Bowseria arctowskii
Isolate number 7866
Collector Jan Pawlowski
Identifier Frédéric Sinniger
Collected on March 2007
Habitat soft sediment
Depth 110m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Foraminifera sp. MH-2011a | genomic DNA | 7866 | taxon:1051355 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattatttaaataattgaagcttcggttgagattatttttatatgtaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagagcttattaaattacgtatgcttgcttgtatatttgacccccaatctttttttttttattttttaactttcaagtcttctggcttttaagtttaaaaatttaattaaaagagattgtgtgtgtgtcatttatgcattaagcagcatacaattaagctctgaaagcaacgaacgtgaccgcatcctcttgttgcctctaattttttatcgttgtattaaacttcggttttttactttgataagtaacagaggctttaaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtgagcatctcatttaaaacaccattgttagctaaatttaattgtttgactttttttatgtttgagaatgctttgagacttcggttgataagtgattttgaatgtgaaggaagttgaattaattttattcagtcaaacgatggttaagcctgcttcgaaagtaagtaggtaatcaatccaaagtaacgatttcccagctttagcacacctatatgcagcgtttgtacccagacataagcttgccttatgttcttgtgtgtatgaatgttttttaactgcatgtgcttgtgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaaatttagttttcttctgaaaattaatattctatagaaacttaaacgaacagtgtggtctaaaggaaagagaagtcg

See sequence on NCBI