Trifarina earlandi

Order “Rotaliida” > Family “Uvigerinidae” > Genus “Trifarina

Original description Parr, W., J., 1950, Repts., Adelaide, ser. B, pt. 6, 5, 340
Further reference Schweizer, M., Pawlowski, J., Duijnstee, I., A., P., Kouwenhoven, T., J., van der Zwaan, G., J., 2005, Mar. Micropal., 57, 51-67 (919 KB)

General description

Subfusiform test lobulate periphery, chambers inflated and overlapping, wall ornamented by narrow, strong costae, aperture with a flaring lip at the end of a short neck.

Representative pictures

Uvigerina earlandi

Specimens

Specimen 1145

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 1145
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1998
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 1145-4b | taxon:324130 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatacttttttcatattccttcgcgggttcgtgttaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcagtttctctaccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggattttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 1145-3 | taxon:324130 | small subunit ribosomal RNA ggcatattaatatatacttttttctattccttcgggttcgtgttaaatgtctatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccattcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgatattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacatattaatttctgtgcaagaaagcttattaaaactaaagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataaacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaattgaattatttgcaagtgaagcatctcatatatatatatataacaccgcatgcgcgagtccatttattcagtttctctacccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggatttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacc

See sequence on NCBI

Specimen 1994

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 1994
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, Explorers Cove

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 1994 | taxon:324130 | small subunit ribosomal RNA gggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatactttttttcattccttcgggtatgttaaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttattacactttgacccctccttcacgggngcgtgtgtctttgactgtttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaanaaagctttttaaactaaagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcagtttctctaccttcacgggtatcgctgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttactttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggatttatccacattgnacncctatggaaacttaaacgaacag

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 1994.4 | J. Pawlowski 1994 (UniGE) | taxon:324130 | small subunit ribosomal RNA | A10-6rA ctacattaacccgacagtttaaataagtgttcatgctatcacgcataacatgcacaatgcacatgtacgcataatacacacacatacacatctgttatgccgtacaagcattagcataaattttgtttacgatagtaacaaaatttcagcgtgaatcacacatacatacgcacagtgaatcacagcgaaattttacacatttcaacgtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacatacatacacacacacacacacgatttctctgtaacgcatattcatacaagaagcacaattgcgttacaccgtgacactttttatcttttttatggataactcagggaaagtttggctaatacgtacgagtacatacacacacacacacacacacacactcacacgtatacactactcagcactcartggtaaactttgatttacgcgtattttatgcgtctatcagtttaaagtttaaccgcaacatgagagacattgagcacgcacgtgtaatgtgaattcgttcacgttacacacctacgctgagcagactttgcgaagtttacttttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgcacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcatacttttattgcaatttactattatacgcattacgacactatttatagatttatttttattctgtcatacacacacacacacatccttgtccacacgcgtaaagtagaaattatatatatcatgtatattttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttttaacggtgttacgtaaaaatttcactgttgatgtatctgaatttcaagtggagggcaagt

See sequence on NCBI

Specimen 2187

Species Rotaliida > Uvigerinidae > Trifarina > Trifarina earlandi
Isolate number 2187
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Trifarina earlandi | genomic DNA | 2187-1 | taxon:324130 | small subunit ribosomal RNA agaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatacttttttgcattccttcgggtatgttaaatgtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttanttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacntatgttgttattacactttgacccctccttcacgggtgcgtgtgtctttgactgtttcaactcatacaattangtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagtttttatgctcttacgtattaatttctgtgcaagaaagctttttaaactanagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttatatacaccgcatgcgcgagtccatttattcnntttctctaccttcacgggtatcgctgttttaaatgtgtatctctccgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgattcctttttttctgcacacatatatacggcagttatacccgggtaaccttgttgttacttttctgtgtgtatagctgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaacacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaattggattttatccacattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Trifarina earlandi | genomic DNA | 2187.3 | J. Pawlowski 2187 (UniGE) | taxon:324130 | small subunit ribosomal RNA | A10-6rA ctcaagattaagccatgcaagtggttacattaacccgacagtttaaataagtgttcattgctatccgcataacacgcacaatgcacatgtacgcataatacacacacatacacatctgttatgccgtacaagcattaggcataaattttgtttgcgatagtaacaaaatttcagcgtgaatcacacatacatacgcacagtgaatcacagcgaaattttacacatttcaacgtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacacacatacacacacacacacacgatttctctgtaacgcatattcatacaagaagcacaattgcgttacaccgtgacactttttatcttttttatggataactcagggaaagtttggctaatacgtacgagtacatacacacacacacacacacacactcacacatatacactactcagcactcaatggtaaactttgatttacgcatattttatgcgtctatcagtttaaagtttaaccgcaacatgagagacattgagcacgcacgtgtaatgtgaattcgtctcacgttacacacctacgctgagcagactttgcgaagtttacttttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcatacttttattgcaatttactattatacgcattacgacactatttatagatttatttttattctgtcatacacacacacatccttgttcacacgcgtaaagtagaaattatatatatcatgtatattttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttttaacggtgttacgtaaaaatttcactgttgatgtatctgaatttcaagtggagggcaagtctggtgc

See sequence on NCBI