Nonionella labradorica

Order “Rotaliida” > Family “Incertae sedis” > Genus “Nonionella

Original description Dawson, J. W., 1860, Canadian Nat. Geol. , Montreal, Canada., 5, 191
Further reference Schweizer, M., Pawlowski, J., Kouwenhoven, T., J., Guiard, J., van der Zwaan, B., 2008, Mar. Micropal., 66 (1.09 MB)
Further reference Cedhagen, T., 1991, Ophelia, 33, 17-30 (7.88 MB)

General description

Equilateral smooth test, last chamber inflated, extends in two lobes on either side of the earlier whorls.

Representative pictures

Nonionella labradorica Nonionella labradorica

Specimens

Specimen 1396

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 1396
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 1999
Location Sweden, Tjärnö

Barcode sequence

SSU partial

>Nonionella labradorica | genomic DNA | 1396 | taxon:313611 | 1396.3 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggcgcattttgttcacattcactttcgcttgcgtttgttgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgccacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcattttatttcagttccattcatttggttctgtttttaagtgtgtttttgcttctgcgcgcggtaaagcctactttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaaggcgtaacaaggcatcggtaggtga

See sequence on NCBI

Specimen 3600

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 3600
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.4 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggcccggacacactgaggattgacaggcaatattaaatactactctaactatactctcgtatatgttctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgttgtattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcatatgttccattcatttggttctattgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgtagcttctgtgcgtatagatgttgaatacacactttttgtgttatattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.5 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactctaactatactcgtatatgttctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtgtaattgcgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcagttccattcatttggttctgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatattttgctttattgcaattttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactctaactatactcgtatatgttctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgctgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcagttccatcatttgggttctgttttaaagtgtgtttttgctctgcgcgcggtaaagcttactgcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.2 | small subunit ribosomal RNA | s14-sB region aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggtgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttatttcagttccattcatttggttctgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU partial

>Nonionella labradorica | genomic DNA | 3600 | taxon:313611 | 3600.6 | small subunit ribosomal RNA | s6-s14 region ccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgccatgaagaatgaatcttaacacctttctactctttgtgtcaacagttttacgtatatgttttgggcttatagttcatttcatatacgttcgacgctgttataagaattttgcttacgcatatacgatttttacacggcacgttagcatacacgcgtatatacaacctacacatacacacccacatttcgttgtatataccgtgtgtgacacacgcagcacttaatttcagaaatgtcttttcgtttgcatttgtgtgtgagacacactttggagcatttattctcatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcgcactttcagccttttagaaagaagcctctcagcttttttctctctctcactcacacatacacacacacacacacacatcgtgaggaggcaaatactataagcgtatctttttttctaaaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattgtattacgctattagtatctctcacacacacacacacacacacatgtggtaacactaattatgcgtatatacattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaacgatgggctctcaattgcaatttctatatagaattgtaaatttcctcaaactgcaaaataacttggcttgagctcgtatcattcttgatacgctcgcctcacttttttcgtacggtctcgacggacgtttcattttatcattttctttgcgtgtaagcattatgtatttattccttgaaacataggaattacattgcgtgcacttgattttcggagctttgcgctcaaatttctggtgagatgtaagcactgtgtttctctgcccgcagcgtatgactatcggtcatttcgttctgtcgtttggtagtttaacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccg

See sequence on NCBI

Specimen 3966

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 3966
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2003
Location Skagerrak

Barcode sequence

SSU partial

>Nonionella labradorica | genomic DNA | 3966 | taxon:313611 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagctgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactaactatactcgtatatgtctgttgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttgataccaacggcgcattttgttcacattcactttcgcttgcgtttgtgtattgtgtataattgtgctgcaaaaaggctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttgatacaccgcatgcgcgggccgcatttattttcagttccattcatttggttctgtttttaagtgtgtttttgctctgcgcgcggtaaagcctacttcgacagtaagtgggtaatcaattagaagtaatgatttccttatttttatagcacacatatatatggcatttatgcccgggttgtactttgttgcagcttctgtgcgtatagatgttgaatacacactttttgtgttattcattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcacatatttgctttattgcattttttgcacgcctatggaaacttaaacgaacagtgtggtgtaaaggaaagagaagt

See sequence on NCBI

Other sequence

SSU partial

>Nonionella labradorica | genomic DNA | 3966 | taxon:313611 | 3966.27 | small subunit ribosomal RNA | s6-s14 region ccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgccatgaagaatgaatcttaacacctttctactctttgtgtcaacagttttacgtatatgttttgggcttatagttcatttcatatacgttcgacgctgttataagaattttgcttacgcatatacgatttttacacggcacgttagcatacacgcgtatatacaaccttacacatacacacccacatttcgttgtatataccgtgtgtgacacacgcagcacttaatttcagaaatgtcttttcgtttgcatttgtgtgtgagacacactttggagcatttattctcatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcgcactttcagccttttagaaagaagcctctcagcttttttctctctctcactatcacacatacacacacacacacacacacatcgtgaggaggcaaatactataagcgtatctttttttctaaaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattgtattacgctattagtatctctcacatacacacacacacacacacacatgtggtaacactaattatgcgtatatacattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttttacatcaaacgatgggctctcaattgcaatttctatatagaattgtaaatttcctcaacctgcaaaataacttggcttgagctcgtatcattcttgatacgctcgcctcacttttttcgtacggtctcgacggacgtttcattttatcattttctttgcgtgtaagcattatgtatttattccttgaaacataggaattacattgcgtgcacttgattttcggagctttgcgctcaaatttctggtgagatgtaagcactgtgtttctctgcccgcagcgtatgactatcggtcatttcgttctgtcgtttggtagtttaacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaaatactactactatactcgtatatgtgctgtatttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacatttacgtgtgttgcggcactttgacccctcttattcacgtaagagcgcgtgtcttagtttttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccg

See sequence on NCBI

Specimen 4836

Species Rotaliida > Incertae sedis > Nonionella > Nonionella labradorica
Isolate number 4836
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2004
Location Svalbard

Other sequence

SSU partial

>Nonionella labradorica | genomic DNA | 4836 | J. Pawlowski 4836 (UniGE) | taxon:313611 | small subunit ribosomal RNA | sA-s6 region ctcaaagattaagccatgcaagtggttacactaacccgacagtttaaataagtgttcaatgctttttccacatatatgatatatacggtctattcgttcacacatacacacacacaccacccgtgctgaacttagattccaacatatatatatatacacacattaagtgaatcactgaattctcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcatacgcgcaatgcatgaatatatacattacgtttcgactattttcgtaattgctcctttcgcctatgcactttacatggtcttccgtgtcgagtgtatctgcaccgggggtattttgtgaaatgcgtcaaatgtattcctattgaaatgcaatgcacggcttacctacacacacacatacacacactgtgatttctctgtttcgcttatctttatttcaaagattgctacgcgttacaccgtgacaacttcttttatttatggataactcagggaaagtttggctaatacgtacgagtatttacacacacacacacacacactctcacacagtgtatatatatatatattggttggtgcatacattttctcacacatcgtgtgtgtattcaaacagtatgtatatatatatgactccctctactcagcactcaatggtagacttttggtttcacgctctgcgtattccagtacaagtttaatcgcaacatgagagacattgagcacgcacgtgatttcgttccctcgggaacttagtcacattcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaattatatattgattattattatgcattatgcgcaaatttacaacatacattatgcaaatcattgtaacactacacacatacacaccctttttactctgtcatcatcatacatagcatatccttgttcgttgtttatttcagcattaaagcgtatatattattaacaccattatatacattcacttttttactgaggcagtgacaagctgtaacggttgagtatttaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttattctctgtaatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgc

See sequence on NCBI